| Popis: |
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degrees C; amplification was made in the thermocycler mode: 1 cycle, 94 degrees C, 3 min; 35 cycles, 94 degrees C, 10 sec; 52 degrees C, 10 sec; 72 degrees C, 15 sec; 1 cycle, 72 degrees C, 1 min. Analysis of nucleotide sequences showed a significant similarity of these DNA samples with the genotype G1 of E. granulosus and revealed nucleotide replacement in position T23A. |
