| Popis: |
APC kolorektal kanserlerin gelişimindeki temel tümör baskılayıcı gendir. Bu mutasyonlar, tümör baskılayıcı APC geninde fonksiyon kaybına neden olarak Wnt yolak aktivasyonuna sebep olur. CRISPR/Cas9 sistemi genomda spesifik bölgelerin hedeflenmesine imkân tanıyan popüler bir genom düzenleme aracıdır. Bu çalışmanın amacı Apc genini CRISPR/Cas9 sistemi ile hedefleyerek kılavuz RNA'nın etkinliğini test etmek ve Apc mutasyonun C2C12 fare miyoblast hücre hattındaki etkilerini araştırmaktır. Araştırmada pX330 ekspresyon plazmidinin içerisine hedef Apc gen dizisinin 16. ekzonunda bulunan GTCTGCCATCCCTTCACGTTAGG (AGG dizisi PAM sekansı) kılavuz RNA dizisi klonlanmıştır. Sekanslama ile doğrulanan pX330-Apc plazmidi ve reporter olarak kullanılan pEGFP plazmidi endo-toksinsiz midiprep yöntemiyle çoğaltılmıştır. Elektroporasyonla C2C12 miyoblast hücreleri transfekte edilmiş ve transfeksiyondan 24, 48 ve 96 saat sonra DNA izolasyonu yapılarak hedef alınan bölge PCR ile çoğaltılmıştır. Pürifikasyon sonrası T7 Endonükleaz I ve Sanger sekanslama ile örnekler mutasyon varlığı açısından değerlendirilmiştir. Kalan transfekte hücreler 14 gün idame ettirilerek morfolojik özellikleri incelenmiş ve hücrelere Oil Red O boyaması yapılmıştır. pEGFP ve pX330-Apc plazmidi ile transfeksiyon sonrası C2C12 hücrelerinde yeşil floresan protein ifadesi tranfeksiyondan 48 saat sonra belirginleşmiştir. pX330-Apc plazmidi ile transfekte edilen C2C12 hücrelerinde Apc gen bölgesinde mutasyon oluşturulduğu Sanger sekanslama ile 48 ve 96 saatten sonra görülmüştür. 14 gün idame ettirilen transfekte hücrelerin sitoplazmalarında mikrovakuoller izlenmiş ve Oil Red O boyamasında sitoplazmik mikroveziküler yapıda biriken materyalin yağ olduğu gözlenmiştir. Bu tez çalışması sonucunda CRISPR/Cas9 sistemi ile fare hücrelerinde seçilen kılavuz RNA test edilmiştir. Ayrıca C2C12 hücrelerinde Apc geninin inaktivasyonu hücrelerin yağlanmasına neden olmuştur. Bulgular Wnt sinyal yolağı ile adipojenez arasında bir ilişki olabileceğini düşündürmektedir. APC is a main tumor suppressor gene in development of colorectal cancers. These mutations lead to Wnt pathway activation resulting in loss of function in the tumor suppressor APC gene. The CRISPR / Cas9 system is a popular genomic editing tool that allows targeting of specific regions in the genome. The aim of this study was to validate the efficiency of the guide RNA by targeting the Apc gene with the CRISPR / Cas9 system and to investigate the effects of the Apc mutation on the C2C12 mouse myoblast cell line. In the study, GTCTGCCATCCCTTCACGTTAGG (underlying sequence is PAM sequence) guide RNA sequence located in exon 16 of the target Apc gene sequence was cloned into pX330 expression plasmid. Plasmid pX330-Apc confirmed by sequencing and plasmid pEGFP used as reporter was amplified by the endo-toxin-free midiprep method. C2C12 myoblast cells were transfected by electroporation and DNA was isolated 24, 48 and 96 hours after transfection and amplified by PCR. After purification, samples were evaluated for T7 endonuclease I and Sanger sequencing in terms of mutation presence. The remaining transfected cells were maintained for 14 days and their morphological characteristics were examined and the cells were subjected to Oil Red O staining. After transfection with pEGFP and pX330-Apc plasmids, C2C12 cells became evident 48 h after transfection of green fluorescent protein. Mutations in the Apc gene region in C2C12 cells transfected with the pX330-Apc plasmid were observed after 48 and 96 hours of sequencing by Sanger. Microvacuoles were observed in the cytoplasm of the transfected cells maintained for 14 days and the material deposited in the cytoplasmic microvesicular structure in Oil Red O staining was observed to be oil. As a result of our studies, the validation of the selected guide RNA in the mouse cells was provided with the CRISPR / Cas9 system. In addition, the inactivation of the Apc gene in C2C12 cells causes lubrication of cells. It suggests that there may be a relationship between Wnt signaling pathway and adipogenesis. |
