Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex
| Autor: | Kane T. McQuaid, Shuntaro Takahashi, Lena Baumgaertner, David J. Cardin, Neil G. Paterson, James P. Hall, Naoki Sugimoto, Christine J. Cardin |
|---|---|
| Rok vydání: | 2022 |
| Předmět: | |
| Zdroj: | Journal of the American Chemical Society. 144:5956-5964 |
| ISSN: | 1520-5126 0002-7863 |
| DOI: | 10.1021/jacs.2c00178 |
| Popis: | The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, con-sistent with its transient formation in live cells. The stabilisation of a particular topology by a small molecule is of great importance for therapeutic applications. Here we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays en-antiospecific G-quadruplex binding. It crystallised in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterised example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a compar-ative ligand binding study, we showed, using a Klenow fragment assay, that the title complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work. |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|