Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer
| Autor: | Hunho Jo, Min Su Han, Kyung-Mi Song, Kyoungin Min, Changill Ban, Sung Ho Jeon, Ja Kang Ku, Minseon Cho, Taisun Kim |
|---|---|
| Rok vydání: | 2011 |
| Předmět: |
Aptamer
Biophysics DNA Single-Stranded Metal Nanoparticles Biochemistry Colorimetry (chemical method) Sepharose Affinity chromatography Kanamycin medicine Molecular Biology Chromatography Chemistry Cell Biology biochemical phenomena metabolism and nutrition Aptamers Nucleotide Anti-Bacterial Agents carbohydrates (lipids) Dissociation constant Kinetics Pharmaceutical Preparations Tobramycin bacteria Colorimetry Naked eye Gold Systematic evolution of ligands by exponential enrichment medicine.drug |
| Zdroj: | Analytical biochemistry. 415(2) |
| ISSN: | 1096-0309 |
| Popis: | A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|
Full Text from ScienceDirect