Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite
| Autor: | Mawethu Pascoe Bilibana, Emmanuel I. Iwuoha, Avril R. Williams, Usisipho Feleni |
|---|---|
| Jazyk: | angličtina |
| Rok vydání: | 2021 |
| Předmět: |
silver nanoparticles
Aptamer Bioengineering 02 engineering and technology lcsh:Chemical technology 01 natural sciences Silver nanoparticle lcsh:Chemistry small-angle X-ray scattering spectroscopy (SAXS) Chemical Engineering (miscellaneous) lcsh:TP1-1185 Detection limit Nanocomposite microcystin-LR Chemistry Process Chemistry and Technology 010401 analytical chemistry 021001 nanoscience & nanotechnology 0104 chemical sciences Dielectric spectroscopy electrochemical aptasensor Linear range lcsh:QD1-999 poly(2 5-dimethoxyaniline) 0210 nano-technology Selectivity Biosensor Nuclear chemistry |
| Zdroj: | Processes, Vol 9, Iss 179, p 179 (2021) Processes Volume 9 Issue 1 |
| ISSN: | 2227-9717 |
| Popis: | This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine R, l-arginine) (MC-LR) containing a 5&prime thiolated 60-mer DNA aptamer (i.e., 5&prime SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3&prime ). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA&ndash PVS&ndash Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA&ndash Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01&ndash 0.1 ng L&minus 1 MC-LR and 0.003 ng L&minus 1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|