| Popis: |
Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′) designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a “bud blight” isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996. |
