Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children
| Autor: | Gregory A. Poland, Hannah M. Salk, V. Shane Pankratz, Beth R. Larrabee, Inna G. Ovsyannikova |
|---|---|
| Rok vydání: | 2015 |
| Předmět: |
Male
Candidate gene Adolescent Genotype Immunology Nectins Single-nucleotide polymorphism Adaptive Immunity medicine.disease_cause Antibodies Viral Rubella Polymorphism Single Nucleotide Article Minor Histocompatibility Antigens Tripartite Motif Proteins Rubella vaccine Interferon-gamma Young Adult Gene Frequency Genetics medicine Humans Genetic Predisposition to Disease Neutralizing antibody Child biology Interleukin-6 Haplotype Rubella virus medicine.disease Acquired immune system Interleukin-10 Receptor beta Subunit Antibodies Neutralizing Repressor Proteins Toll-Like Receptor 4 Haplotypes biology.protein Female Cell Adhesion Molecules Measles-Mumps-Rubella Vaccine medicine.drug |
| Zdroj: | Immunogenetics. 67(10) |
| ISSN: | 1432-1211 |
| Popis: | The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|
Full text from SpringerLink