Three novelHBBmutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients
| Autor: | María Teresa Magaña-Torres, Francisco Javier Perea-Díaz, Josefina Yoaly Sánchez-López, Víctor Manuel Rentería-López, B. Ibarra, L. C. Rizo-de-la-Torre |
|---|---|
| Rok vydání: | 2017 |
| Předmět: |
Adult
Male 0301 basic medicine Adolescent Genotype Thalassemia DNA Mutational Analysis Clinical Biochemistry Population beta-Globins Gene mutation Biology medicine.disease_cause Genetic Heterogeneity Young Adult 03 medical and health sciences 0302 clinical medicine medicine Humans Allele Child Codon education Mexico Gene Alleles Aged Genetics education.field_of_study Mutation Microcytosis beta-Thalassemia Biochemistry (medical) Infant Exons Sequence Analysis DNA Hematology General Medicine Middle Aged medicine.disease Molecular biology Introns 030104 developmental biology Child Preschool Female Allelic heterogeneity 030215 immunology |
| Zdroj: | International Journal of Laboratory Hematology. 39:539-545 |
| ISSN: | 1751-5521 |
| Popis: | Introduction Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. Methods One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Results Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Conclusion Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|
| Nepřihlášeným uživatelům se plný text nezobrazuje | K zobrazení výsledku je třeba se přihlásit. |