Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Autor:	Simon Rüdisser, Geoffrey Bodenhausen, Dimitri Bytchenkoff, Elisabetta Chiarparin, Dominique Früh
Rok vydání:	2002
Předmět:	chemistry.chemical_classification Base pair Hydrogen bond Relaxation (NMR) Scalar (mathematics) RNA chemistry.chemical_element General Chemistry Oligomer Nitrogen chemistry.chemical_compound Crystallography chemistry Computational chemistry General Materials Science Nucleotide
Zdroj:	Magnetic Resonance in Chemistry. 40:377-379
ISSN:	0749-1581
DOI:	10.1002/mrc.1018
Popis:	The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was obsd. to decrease monotonically for all four base pairs with increasing temp. The temp. dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chem. shift modulation to relaxation rates. [on SciFinder (R)]
Databáze:	OpenAIRE
Externí odkaz:	https://explore.openaire.eu/search/publication?articleId=doi_________::fd38a6c0d9eb2c5cbef47c8be1af1a2b https://doi.org/10.1002/mrc.1018 Zobrazit plný text záznamu Plný text