Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens

Autor: Pritam Kundu, Jayanta Bhaduri, Subhash Kanti Roy
Rok vydání: 2018
Předmět:
Zdroj: African Journal of Microbiology Research. 12:655-663
ISSN: 1996-0808
DOI: 10.5897/ajmr2018.8872
Popis: Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591, KY636360, KY671245, KY631490, KX587469, KY859856, KX665546, KX608590, KX587468, KY859798, KY636357, KY636361, KY 636359, KY631491, KY 859855, KY636358, KY636362) after submitting the contig. FASTA sequence in NCBI database was seen. All most all 23 bacterial strains (viz. TS-1-16, TS-4-23 DJ-1-22, DS-1-20, AS-1-4, DJ-1-24 , DJ-1-10, DJ-1-46) showed strong homology with free living nitrogen fixing soil bacteria, also showing (98 to 100%) identity and E-value of 00 with Burkholderia spp, Strain-S-9-19, Str-S-9-15, SP-2386, Stenotrophomonas maltophilla, strn-MM-3-3, Str-D-3,LP-05, Bacillus cereus Strn-FORC021and Azospirillum sp TSH51 gene, having good nitrogen fixing capacity. Phylogenetic tree analysis among the 23 isolates and between the different strains from GenBank showed close similarity. Most of the isolated bacterial strain identified as a member of the genus Burkholderia sp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp would be consider to be the most suitable bioferiliser for organic and conventional tea gardens of North Bengal, India. Key words: Molecular phylogeny, RAPD, 16SrRNA sequencing, free living, N2 fixing soil bacteria.
Databáze: OpenAIRE