First Report of Watermelon Green Mottle Mosaic Virus in North America

Autor: T. L. Pitman, K. G. Posis, Tongyan Tian, Bryce W. Falk, Avijit Roy, C. A. Belanger
Rok vydání: 2019
Předmět:
Zdroj: Plant Disease. 103:3288
ISSN: 1943-7692
0191-2917
DOI: 10.1094/pdis-02-19-0308-pdn
Popis: In 2013, cucumber green mottle mosaic virus (CGMMV), a seed-transmitted cucurbit-infecting member of the genus Tobamovirus, was detected in California (Tian et al. 2014). CGMMV is a quarantined pathogen for which the California Department of Food and Agriculture monitors. Diagnostic samples suspected of CGMMV infection led to the identification of a different virus, watermelon green mottle mosaic virus (WGMMV), of the genus Tobamovirus, in November 2017. WGMMV was recently described by Cheng et al. (2018) infecting watermelon in Taiwan. In November 2017, two opo gourd fruits exhibiting CGMMV-like symptoms collected from a Santa Clara County farmer’s market, and 25 leaf samples from a mixed cucurbit production block from a Fresno County farm were tested for CGMMV by ELISA (Agdia, Elkhart, IN) and transmission electron microscopy. Most samples were CGMMV positive. However, rigid rod-shaped particles (∼18 × 300 nm) were detected from several CGMMV-negative samples. These samples tested positive by ELISA against tobacco mosaic virus (Agdia), indicating the presence of a serologically related virus. Initial nucleic acid analysis of the 2017 isolate by reverse-transcription polymerase chain reaction (RT-PCR) from total plant RNA using tobamovirus primers, as previously described by Dovas et al. (2004), resulted in a 497-nucleotide (nt) amplicon whose sequence aligned with other tobamovirus RNA-dependent RNA-polymerase sequences in GenBank. Sanger sequencing of this amplicon and 5′ and 3′ rapid amplification of cDNA ends (RACE) of genomic RNA (FirstChoice RLM-RACE kit, Thermo Fisher Scientific, Waltham, MA) with primer walking resulted in assembling the full 6,482-nt genome, which was deposited in GenBank (accession MK070867). An NCBI BLAST search indicates the isolate shares 98% sequence identity with WGMMV (accession MH837097) and 82% with cucumber mottle virus (accession AB261167) (Altshul et al. 1990; Orita et al. 2007). WGMMV-positive samples came from opo gourd (Lagenaria siceraria), fuzzy gourd (Benincasa hispida), Asian pumpkin (Cucurbita pepo), Japanese cucumber (Cucumis sativus), and bitter melon (Momordica charantia). Many plants were coinfected with CGMMV and WGMMV, but single infections were identified by RT-PCR from bitter melon and used for mechanical transmission. Detection primers were CGMMV_CP_F, CTTACAATCCGATCACACCTAG; CGMMV_CP_R, CTAAGCTTTCGAGGTGGTAGC; WGMMV4F, CTGCTAAGAGGGTTTATG; and WGMMV4R, CTTGGAAATCCGGTAAG. Transmission studies using Nicotiana benthamiana, sugar pumpkin, cucumber, watermelon, and Chenopodium amaranticolor were carried out as previously described (Ciuffo et al. 2016). Control plants were mock inoculated with buffer. At 10 days postinoculation, plants inoculated with infected leaf tissue, except C. amaranticolor, had slightly distorted leaves, mild mottling, and a crinkled appearance on new growth. Distal leaves of inoculated plants, except C. amaranticolor, tested positive for WGMMV by RT-PCR, and mock-inoculated plants were negative. C. amaranticolor developed local lesions on inoculated leaves. All plants were CGMMV negative by RT-PCR. During this work a second WGMMV detection occurred in June 2018 in Fresno County, also from a mixed cucurbit field. Both detections represent the first time WGMMV has been identified in California and North America and the second detection of the virus in cucurbit crops. The economic impact, means of transmission, and spread of this virus are currently unknown and merit further study.
Databáze: OpenAIRE
Externí odkaz: