Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis
| Autor: | Edith del Carmen Hernández Rojas, Johanna Lizeth González Devia, Carmen Cecilia Almonacid Urrego, Nadia Guadalupe Tapia Pastrana, Araceli Consuelo Hinojosa Juarez, Marco Tulio Reynoso Marenco, Hugo Mendieta Zerón, Melanie Molina Alvarado, Yesica Maria Rodriguez Cortes |
|---|---|
| Rok vydání: | 2017 |
| Předmět: |
Prognostic variable
medicine.medical_specialty biology Receiver operating characteristic Homocysteine Proportional hazards model business.industry medicine.medical_treatment 030232 urology & nephrology General Medicine 030204 cardiovascular system & hematology Gastroenterology 03 medical and health sciences chemistry.chemical_compound 0302 clinical medicine chemistry Methylenetetrahydrofolate reductase Internal medicine biology.protein medicine Hemodialysis Risk factor Prospective cohort study business |
| Zdroj: | Journal of Medical Sciences. 17:89-94 |
| ISSN: | 1682-4474 |
| Popis: | Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Dario Fernandez Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|