First Report of Xanthomonas vasicola pv. vasculorum, the Causal Agent of Bacterial Leaf Streak of Corn, in South Dakota

Autor: M. Nampijja, Febina M. Mathew, Emmanuel Byamukama, C. Tande, B. Bleakley
Rok vydání: 2020
Předmět:
Zdroj: Plant Disease. 104:1851-1851
ISSN: 1943-7692
0191-2917
Popis: During routine scouting of corn (Zea mays L.) in 2018, corn leaves exhibiting bacteria-like symptoms were identified in Clay County, South Dakota. Symptomatic leaves showed narrow long lesions with wavy water-soaked margins, typical of bacterial leaf streak of corn caused by Xanthomonas vasicola pv. vasculorum (Korus et al. 2017). Incidence was near 100%, and the severity ranged from moderate to very severe across the field. Small sections of the symptomatic tissue were placed onto a stereomicroscope, and bacterial streaming was readily observed. The corn leaves were then surface sterilized by washing in 10% bleach for 30 s and rinsing three times in sterile water, placed on a modified King’s B medium, and incubated at 30°C for 48 h. Bacterial growth from two independent leaf samples was transferred onto fresh King’s B medium and incubated as previously stated. After 48 h, yellow, viscous mucoid bacterial colonies were observed on the medium. Surface-sterilized symptomatic leaf tissues were cut into 1-cm sections and placed in a 50-ml centrifuge tube and soaked overnight to allow for bacteria to ooze out of the leaf pieces. The leachate was used to extract DNA using the Ultra DNAeasy kit following the manufacturer’s instructions (Qiagen, Redwood, CA). PCR was run on the extracted DNA using putative membrane protein and putative exported protein primers (Xvv3_F, CAAGCAGAGCATGGCAAAC; Xvv3_R, CACGTAGAACCGGTCTTTGG; Xvv5_F, CCGTCGAAATGGTCTCAACT; Xvv5_R, CGGAAGAGTTGGAAGACAGC) (Lang et al. 2017). A negative check was DNA extracted from asymptomatic leaf tissue. The expected product size of 200 bp was obtained from the symptomatic leaves’ leachate DNA only. The PCR amplicons were sequenced at Functional Bioscience in Wisconsin. The resultant sequences were subjected to BLASTn analysis under the plant-associated environmental database and showed a 100% match to X. vasicola pv. vasculorum with 100% sequence coverage. The sequences of one isolate (based on the putative membrane protein primers) were submitted to GenBank (accession MN813968). The isolates were also subjected to biochemical tests and were positive for esculin hydrolysis and cytochrome oxidase, formed mucoid yellow colonies on yeast dextrose agar, and were negative for arabinose utilization. The morphological characteristics along with biochemical and PCR tests confirmed X. vasicola pv. vasculorum as the causal organism of the symptoms observed on corn. To complete Koch’s postulates, eight corn plants (hybrid DKC45-65RIB) were spray inoculated with a bacterial suspension of 1.48 × 10⁷ CFU at the V6 growth stage. Three corn plants were sprayed with distilled water as controls. All plants were placed in a humid chamber for 48 h and then transferred to the greenhouse with lighting set at 14/10 h of light/darkness and an average temperature of 26°C. This was repeated twice. Plants inoculated with the bacterial suspension developed long, narrow, wavy water-soaked lesions 5 to 6 days postinoculation, whereas no symptoms were observed in the control plants. Bacterial colonies were reisolated from inoculated plants only and were confirmed as X. vasicola pv. vasculorum by PCR as above. At this time, bacterial leaf streak seems to be localized but could spread to more corn fields. The impact of bacterial leaf streak on yield is not yet known. There is a need to create awareness among corn growers about the appropriate management practices for controlling this new bacterial disease.
Databáze: OpenAIRE
Externí odkaz: