| Autor: |
Troitsky, A.V., Bobrova, V.K., Ponomarev, A.G., Antonov, A.S. |
| Zdroj: |
FEBS Letters; January 1984, Vol. 176 Issue: 1 p105-109, 5p |
| Abstrakt: |
The complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicumwas determined to be OHUAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAAC OH. The sequence differs from that of a fern Dryopteris acuminataand of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants. |
| Databáze: |
Supplemental Index |
| Externí odkaz: |
|
Plný text