First report of groundnut ringspot virus in Physalis angulata L.

Autor: Boari, Alessandra de Jesus, Kauffmann, Caterynne de Melo, Quadros, Ayane Fernanda Ferreira
Předmět:
Zdroj: Journal of Plant Pathology; Nov2019, Vol. 101 Issue 4, p1247-1247, 1p
Abstrakt: Subsequently, RT-PCR was performed using the universal primer pair for tospovirus species BR60 (5' AGAGCAATCGTGTCA 3'), designed in the 3' terminal 15 nucleotides of the non-translated region of S RNA, and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3'), designed in the N gene, at nucleotide positions 433-453 (Eiras et al. [1]). Results showed the presence of groundnut ringspot virus (GRSV) with nucleotide and amino acid identity of 96-98%, and 98-100%, respectively, with other GRSV sequences available in GenBank. Plants of I P. angulata i , I Datura stramonium, i and I Nicotiana tabacum i "TNN" reacted with symptoms of systemic necrosis. [Extracted from the article]
Databáze: Complementary Index