Abstrakt: |
Subsequently, RT-PCR was performed using the universal primer pair for tospovirus species BR60 (5' AGAGCAATCGTGTCA 3'), designed in the 3' terminal 15 nucleotides of the non-translated region of S RNA, and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3'), designed in the N gene, at nucleotide positions 433-453 (Eiras et al. [1]). Results showed the presence of groundnut ringspot virus (GRSV) with nucleotide and amino acid identity of 96-98%, and 98-100%, respectively, with other GRSV sequences available in GenBank. Plants of I P. angulata i , I Datura stramonium, i and I Nicotiana tabacum i "TNN" reacted with symptoms of systemic necrosis. [Extracted from the article] |