Abstrakt: |
Iridovirus infection has spread an outbreak in several islands of Indonesia. The cumulative mortality because of the disease sometimes reached 50 % to 90 % over two months. The disease often attacks the grouper marine cultures and it is difficult to eradicate. The study aimed to identify the virus based on clinical signs, co-agglutination test, molecular test, and histopathological changes. Number of 30 grouper fish from several marine cultures suffered from iridovirus infection with clinical signs, such as anorexia, mucoid and opaque faecal casting, and a darkened body was used as samples. Co-agglutination test was using in-house anti-iridovirus rabbit sera coupled to protein A of Staphylococcus aureus. Organs of infected fish, such as gill, spleen, liver, gonad, and eye that were tested by sero-diagnostic kit (own product) and also examined by reverse-transcriptase polymerase chain reaction. Primers used were a forward primer 5’– CTCAAACACTCTGGCTCATC–3’, and a reverse primer 5’–GCACCAACACATCTCCTATC–3’. Histopathological changes of those organs were also examined. Positive iridovirus infection with the co-agglutination test was looked like a lump of sand, from those organs. Molecular analysis appeared the sharp band on 570 base pair from spleen, gonads, gill, and liver. The histopathological changes showed inflammation and some small-size inclusion body bearing cell of spleen, gonad, gill, and liver. Iridovirus is not only transmitted horizontally but also vertically through infected gonad. [ABSTRACT FROM AUTHOR] |