| Autor: |
GALAN, Gloria L., MENDEZ, Noe P., DELA CRUZ, Reggie Y. |
| Předmět: |
|
| Zdroj: |
Annals of West University of Timisoara: Series of Biology; 2018, Vol. 21 Issue 1, p93-102, 10p |
| Abstrakt: |
This study focused on DNA barcoding and phylogenetic tree construction of three selected gastropod species viz., Pomacea canaliculata, Helicostyla sp. and Vivipara costata using cytochrome oxidase I (COI) gene. Genomic DNA samples of selected gastropod species were successfully isolated using modified cetyltrimethylammonium bromide (CTAB) extraction method. A set of primers, LCO1490 (5'GGTCAAATCATAAAGATATTGG 3') and HCO2198 (5' TAAACTTCAGGGTGACCAAAAAATCA 3') was used for the amplification of COI gene of mitochondria. Analysis of homology using BLASTn revealed that P. canaliculata (identified based on morphology) matched with P. canaliculata (AB728585.1), while previously identified Helicostyla sp.(identified based on morphology) was closest to Macrochlamys sp. (MF983631.1) and V. costata (identified based on morphology) was most similar to Bellamya aeruginosa (KP150594.1) in the BLAST analysis. The morphological identification of P. canaliculata was proven correct with 100% similarity to all existing P. canaliculata sequences using BLASTn analysis. However, BLASTn showed that Helicostyla sp. and V. costata were closest to Machrochlamys sp. and B. aeruginosa with 91% and 94% similarity, respectively. The low similarity may suggest that this study is the first to submit COI sequences for Helicostyla sp. and Vivipara costata. Further, the three species had no match in the Barcode of Life Database (BOLD). The Maximum Likelihood tree revealed that the selected gastropod species were clustered together and strongly supported with a high bootstrap value of 98%. It is concluded, however, that COI gene as DNA barcode could be used to discriminate the three studied gastropod species. [ABSTRACT FROM AUTHOR] |
| Databáze: |
Complementary Index |
| Externí odkaz: |
|
