Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.
| Autor: | Tan JA; Department of Biomedical Science, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia., Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, Kho SL, Chua KH, Chen JJ, George E |
|---|---|
| Jazyk: | angličtina |
| Zdroj: | Public health genomics [Public Health Genomics] 2015; Vol. 18 (1), pp. 60-4. Date of Electronic Publication: 2014 Nov 19. |
| DOI: | 10.1159/000368342 |
| Abstrakt: | Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. (© 2014 S. Karger AG, Basel.) |
| Databáze: | MEDLINE |
| Externí odkaz: |
|