The canine copper toxicosis locus is not syntenic with ATP7B or ATX1 and maps to a region showing homology to human 2p21

Autor: Susan L. Dagenais, Ann C. Burgess, George J. Brewer, Rob Loechel, Thomas W. Glover, María Luisa Guevara-Fujita, Vilma Yuzbasiyan-Gurkan, Diane E. Miller
Rok vydání: 1999
Předmět:
Zdroj: Mammalian genome : official journal of the International Mammalian Genome Society. 10(7)
ISSN: 0938-8990
Popis: Canine copper toxicosis (CT) is an autosomal recessive disorder resulting in accumulation of copper at toxic levels in the liver owing to deficient excretion via the bile (Hardy et al. 1975). This disorder is prevalent in certain breeds, most notably the American and British Bedlington Terrier, where disease allele frequencies as high as 0.5 are present, resulting in phenotype frequencies of 25% affected and 50% carriers (Herrtage et al. 1987). Affected dogs develop excessive amounts of copper in their liver and, if untreated, will die of liver disease between 3 and 7 years of age. The gene responsible for canine CT is unknown, but candidates include ATP7B, the gene responsible for Wilson disease in humans (Bull et al. 1993; Tanzi et al. 1993), and the ATX1 (ATOX1 or HAH1) gene, which codes for a copper chaperone that delivers copper to ATP7B within liver cells (Klomp et al. 1997; Hung et al. 1998). Wilson disease in humans is similar to canine CT in that it is also an autosomal recessive disorder where copper accumulates in the liver owing to deficient copper excretion in the biliary system (Brewer and Yuzbasiyan-Gurkan 1992; Bull and Cox 1994). The protein product of ATP7B is a P-type ATPase which is expressed in the liver, kidney, and brain and functions to transport copper in the secretory pathway. Patients with Wilson disease accumulate excess copper primarily in their liver, and over time copper levels in the brain also increase, leading to a movement-type neurological disorder. Thus, the clinical phenotype is similar to canine CT, but differences exist. Neurological manifestations are not seen in canine CT, and affected Wilson disease patients have low levels of ceruloplasmin in their serum, while affected Bedlington terriers have normal levels of serum ceruloplasmin. In addition, the subcellular localization of copper accumulation in the liver differs between affected Wilson disease patients and affected Bedlington terriers. Wilson disease patients accumulate copper in their periportal hepatocytes, while affected Bedlington terriers accumulate copper in the center of the lobules (Owen and Ludwig 1982). HAH1 (ATOX1) (Klomp et al. 1997), the human ortholog of yeast Atx1p, is a cytoplasmic protein that functions as a copper chaperone and is thought to shuttle copper from the cell membrane to both ATP7B and ATP7A (Pufahl et al. 1997) localized in the trans Golgi complex (Dierick et al. 1997; Payne et al. 1998). While not as strong a candidate as the ATP7B gene, it is possible that a mutation in ATX1 could result in liver cirrhosis via interfering with the normal function of ATP7B without affecting the activity of ATP7A. No mammalian disorders have yet been attributed to a mutation in the ATX1 gene. Yuzbasiyan-Gurkan et al. (1997) performed linkage analysis with several Bedlington terrier pedigrees of the American Kennel Club to identify DNA microsatellite marker C04107 as being tightly linked to the CT locus with a LOD score of 5.96 at recombination fraction of zero. This polymorphic marker has been successfully applied in molecular diagnostic tests for CT in Bedlington terriers (Holmes et al. 1998; Ubbink et al. 1998). In an earlier study (Yuzbasiyan-Gurkan et al. 1993), the CT locus was found to be unlinked to the esterase D (ESD) and retinoblastoma (Rb1) loci, both of which show strong linkage to Wilson disease in humans. This suggested that the CT and ATP7B loci were different and unlinked in the dog, but data on linkage of the canine ATP7B, Rb1, and ESD loci is lacking and could differ from that seen in the human genome. In the present study, fluorescent in situ hybridization (FISH) was performed to determine whether candidate genes ATP7B or ATX1 mapped to the same or to different chromosomal locations from C04107. If either ATP7B or ATX1 mapped to the same chromosomal locus as C04107, it would suggest that CT may be a result of a mutation in that gene. If they mapped to different chromosomes, this would strongly support the hypothesis that another gene involved in mammalian copper transport or homeostasis is responsible for canine CT. A canine BAC library constructed from Doberman Pinscher DNA (Roswell Park Cancer Institute, RPCI, Buffalo, N.Y.) was screened with random primed (RediprimeTM II DNA Labeling System, Amersham Life Sciences, Arlington Heights, Ill.) P-labeled probes prepared from PCR products specific for the C04107, ATP7B, and ATX1 loci. PCR primers (forward-58 CCGGATCCTTTAGATGGGAC 38; reverse-58 CAGGTACCCAAGTCATTTGTCTATC 38) designed from sequence upstream of the cytosine-adenine (CA) repeat of microsatellite marker C04107 were used with dog spleen total genomic DNA as template in PCR reactions to generate the CT-specific probe. An ATP7B-specific probe was generated from a PCR reaction using primers (forward58 GACAAAACTGGCACCATACGCACG 38; reverse-58 GTTCTGGAGCTCCTGGACCTTGGCCAG 38) designed from canine exons 14 and 18 and a canine cDNA subclone, which contains ATP7B transmembrane domains 6–8, as template. HAH1 (ATX1) specific primers (forward-58 CAGTCATGCCGAAGCACGAG 38; reverse-58 CTGAGGGTCTCCGCAGGAAC 38) were used with human cDNA as template in a PCR reaction to generate a probe which was used in cross-species hybridization of the canine BAC filters. All PCR products used as probes were checked by sequencing with an Applied Biosystems model 373A automated sequencer. Positive BAC clones were purchased from RPCI and verified as having the correct loci by PCR and Southern blot analysis as well as sequencing. Canine BAC clones 27N21 and 225B1 contain the CA microsatellite C04107 as well as the upstream sequence used to generate the CT-specific probe. Minimally, exons 17 and 18 of the ATP7B gene are contained within BAC clone 243F13, while BAC clone 84B18 contains the ATX1 gene. To map the chromosomal location of these loci, BAC clones Correspondence to: S.L. Dagenais Mammalian Genome 10, 753–756 (1999).
Databáze: OpenAIRE
Externí odkaz: