Giraffa tippelskirchi Matschie 1898
| Autor: | Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre |
|---|---|
| Rok vydání: | 2020 |
| Předmět: | |
| DOI: | 10.5281/zenodo.4332077 |
| Popis: | Giraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost. Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669 |
| Databáze: | OpenAIRE |
| Externí odkaz: |
|