Zobrazeno 1 - 10
of 19
pro vyhledávání: '"Vladislav Yu Kudrya"'
Autor:
Oleg A. Yeshchenko, Sergii Golovynskyi, Vladislav Yu Kudrya, Anastasiya V. Tomchuk, Igor M. Dmitruk, Nataliya I. Berezovska, Petro O. Teselko, Ting Zhou, Bin Xue, Iuliia Golovynska, Danying Lin, Junle Qu
Publikováno v:
ACS Omega, Vol 5, Iss 23, Pp 14030-14039 (2020)
Externí odkaz:
https://doaj.org/article/6b46b350f2734982a8108ccc8bfe63c2
Autor:
Sergii Golovynskyi, Igor Dmitruk, Anastasiya V. Tomchuk, Vladislav Yu. Kudrya, Junle Qu, Bin Xue, N. I. Berezovska, P. O. Tesel’ko, Oleg A. Yeshchenko
Publikováno v:
ACS Applied Nano Materials. 2:7152-7161
A reliable photoluminescence (PL) spectroscopy and imaging of biomolecules at room temperature is a challenging and important problem of biophysics, biochemistry, and molecular genetics. A unique effect of strong plasmonic enhancement of the PL by me
Autor:
Valeriy M. Yashchuk, Kateryna I. Kovalyuk, G. V. Klishevich, Igor Dubey, V. I. Mel’nik, Olesya I. Batsmanova, Vladislav Yu. Kudrya
Publikováno v:
Molecular Crystals and Liquid Crystals. 639:151-159
Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optic...
Publikováno v:
Methods and applications in fluorescence. 5(1)
This paper summarizes the results of studies of the spectral properties-optical absorption, fluorescence and phosphorescence-of DNA and RNA macromolecules and synthetic poly-, oligo- and mono-nucleotides, which have been carried out in our laboratory
Autor:
V. I. Mel’nik, Volodymyr P. Vorob'yov, Svitlana M. Levchenko, Valeriy M. Yashchuk, G. V. Klishevich, Zenoviy Yu. Tkachuk, Dmytro M. Hovorun, Vladislav Yu. Kudrya
Publikováno v:
Molecular Crystals and Liquid Crystals. 535:93-110
The optical absorption, fluorescence, and phosphorescence spectra of RNAs and oligonucleotides of different origin, as well as their mixtures with human albumin are investigated. It is confirmed that the energy structures of DNA, RNA, and complex pro
Publikováno v:
Molecular Crystals and Liquid Crystals. 467:311-323
Spectral properties, energy structure, and electronic processes in DNA, poly(dAdT)2, d(CCCGGGTTTAAA), d(ATC), d(AT), dGMP, dAMP, dCMP, dTMP were studied. The DNA lowest excited electronic singlet and triplet levels are connected with guanine and aden
Autor:
Mykhaylo Yu. Losytskyy, Hiroaki Suga, Vladislav Yu. Kudrya, Valeriy M. Yashchuk, Tymish Y. Ohulchanskyy
Publikováno v:
Journal of Molecular Liquids. 127:79-83
The spectral peculiarities of the DNA, the polynucleotide poly(dAdT) 2 , the oligonucleotide d(CCCGGGTTTAAA), the trimer d(ATC) and the low molecular model compounds dGMP, dAMP, dCMP and dTMP were studied. The system of energy sites and electronic pr
Autor:
Yuriy T. Kononenko, Jan Pielichowski, Dariusz Bogdal, Aleksandra Hanusek, Valeriy M. Yashchuk, Kostyantyn M. Kushnir, Vladislav Yu. Kudrya
Publikováno v:
Journal of Molecular Liquids. 105:185-190
The absorption, fluorescence and phosphorescence of two novel polyorganophosphazenes containing separated carbazole side groups, a polymer chain with spacers (Pf2-sep) and without spacer (Pf2-conj), were studied. It was shown that spectral properties
Autor:
Jan Pielichowski, Valeriy M. Yashchuk, Tymish Yu. Ogul'chansky, Dariusz Bogdal, Vladislav Yu. Kudrya, M. Warzała
Publikováno v:
Journal of Applied Polymer Science. 84:1650-1656
The alkyl methacrylates with halogenated carbazolyl pendant groups were prepared, and the analysis of their absorption and emission spectra showed that the polymers containing monohalogenatged carbazole rings were capable of exhibiting a high singlet
Autor:
Tetyana B. Zheltonozhskaya, Irina Lebedyeva, Olga Demchenko, Vladislav Yu. Kudrya, Valeriy M. Yashchuk
Publikováno v:
Macromolecular Symposia. 166:243-248
The peculiarities of sorption mechanism of phenole molecules by poly(vinylalcohol) and poly(acrylamide) (PVA-PAA N ) films are examined. An analytical model of absorption process based on diffusive character of penetration of phenole molecules in pol