Zobrazeno 1 - 10
of 79
pro vyhledávání: '"V. I. Mel′nik"'
Temperature Dependence of the Luminescence Spectra of a 5CB Liquid Crystal and its Phase Transitions
Publikováno v:
Journal of Applied Spectroscopy. 85:904-908
The spectroluminescence properties of 4cyano4'pentylbiphenyl CH3(CH2)4(C6H4)2CN (5CB) were studied in the temperature range 4.2–297 K. A red shift of the fluorescence spectrum was noted with increasing temperature. The long-wavelength shifts in the
Autor:
Valeriy M. Yashchuk, Kateryna I. Kovalyuk, G. V. Klishevich, Igor Dubey, V. I. Mel’nik, Olesya I. Batsmanova, Vladislav Yu. Kudrya
Publikováno v:
Molecular Crystals and Liquid Crystals. 639:151-159
Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optic...
Autor:
Ludwik Adamowicz, O. S. Pyshkin, L. M. Buravtseva, D. I. Zloba, M. A. Strzhemechny, G. V. Klishevich, Yu.P. Piryatinski, Stepan G. Stepanian, V. I. Mel’nik
Publikováno v:
Chemical Physics. 463:58-64
Luminescence and other properties of solid 2-bromobenzophenone demonstrate features, which require special attention. We present results, which include DFT calculations, integrated and time-resolved phosphorescence spectra, and excitation spectra. Th
Publikováno v:
Journal of Luminescence. 168:43-48
On the basis of the assumption concerning the symmetric properties of the free aromatic hydrocarbon molecules and those placed in host crystalline lattice cell, the analysis of the multiplet structure of the optical spectra of impurity centers of som
Autor:
Yu.M. Kudrya, V. Yu. Kudrya, O.I. Batsmanova, Antonina Naumenko, Valeriy M. Yashchuk, G. V. Klishevich, I. Ya. Dubey, V. I. Mel’nik, K.I. Kovalyuk
Publikováno v:
Ukrainian Journal of Physics; Vol. 61 No. 6 (2016); 516
Український фізичний журнал; Том 61 № 6 (2016); 516
Український фізичний журнал; Том 61 № 6 (2016); 516
The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two ty
Autor:
V. I. Mel’nik, Volodymyr P. Vorob'yov, Svitlana M. Levchenko, Valeriy M. Yashchuk, G. V. Klishevich, Zenoviy Yu. Tkachuk, Dmytro M. Hovorun, Vladislav Yu. Kudrya
Publikováno v:
Molecular Crystals and Liquid Crystals. 535:93-110
The optical absorption, fluorescence, and phosphorescence spectra of RNAs and oligonucleotides of different origin, as well as their mixtures with human albumin are investigated. It is confirmed that the energy structures of DNA, RNA, and complex pro
Autor:
V. V. Shimanovskaya, T. V. Bezrodnaya, Lev M. Babkov, G. A. Puchkovskaya, S. V. Trukhachev, V. I. Mel’nik
Publikováno v:
Journal of Structural Chemistry. 47:946-951
IR spectroscopy methods (experiment, theoretical simulation) have been applied to study the structural features and intermolecular interactions in a two-component heterogeneous nano-size system benzophenone-titanium dioxide (BPh-TiO2). IR spectra of
Publikováno v:
Russian Journal of Nondestructive Testing. 42:525-529
Improving the effectiveness of nondestructive testing of railway rolling stock’s wheel-pair components during their manufacturing and repair is considered. The results of metallographic studies of PY-1 and PY-1III solid-rolled wheels and axles, ana
Publikováno v:
Journal of Molecular Structure. :73-77
The Raman spectrum (7–3400 cm−1) measured for a metastable β-phase of benzophenone is reported for the first time. The Raman spectra measured during the structural phase transition between the metastable β-phase and the stable α-phase (in the