Zobrazeno 1 - 10
of 347
pro vyhledávání: '"V. A. Mel'nik"'
Publikováno v:
Sistemnì Doslìdženâ ta Informacìjnì Tehnologìï, Iss 4 (2019)
The method of finite-difference approximations, advanced by C. Bardos and H. Brezis for the nonlinear evolutionary equations, is generalized on differential-operational inclusions which are tightly connected to evolutionary variational inequalities i
Externí odkaz:
https://doaj.org/article/475ebdc16930445783276fb66a3c6480
Publikováno v:
Sistemnì Doslìdženâ ta Informacìjnì Tehnologìï, Iss 3 (2018)
We consider the main classes of Wλ0-pseudomonotone multi-valued maps. The main properties of these operators have been investigated. The new classes of these operators have been obtained.
Externí odkaz:
https://doaj.org/article/2ec090ecc44b4ee19a5e2274353208fa
Publikováno v:
Тонкие химические технологии, Vol 9, Iss 6, Pp 103-109 (2014)
In the article the environmental management system at the enterprises of the petrochemical complexes and ecoanalytical laboratory activities as a part of it are considered. In addition to its direct responsibilities for the analysis of the test mater
Externí odkaz:
https://doaj.org/article/512250133123481798e42107a4724097
Publikováno v:
Mining informational and analytical bulletin. :255-263
Geophysical methods of research of rock mass are one of the most effective ways of solving various problems in mining and are widely used in mining, gas and oil industry, as well as in science. They allow remote search and assessment works, detection
Temperature Dependence of the Luminescence Spectra of a 5CB Liquid Crystal and its Phase Transitions
Publikováno v:
Journal of Applied Spectroscopy. 85:904-908
The spectroluminescence properties of 4cyano4'pentylbiphenyl CH3(CH2)4(C6H4)2CN (5CB) were studied in the temperature range 4.2–297 K. A red shift of the fluorescence spectrum was noted with increasing temperature. The long-wavelength shifts in the
Publikováno v:
Sistemnì Doslìdženâ ta Informacìjnì Tehnologìï, Iss 1 (2009)
For a large class of operator inclusions, including those generated by maps of Sk type, we obtain a general theorem on existence of solutions. We apply this result to some particular examples. This theorem is proved using the method of Faedo-Galerkin
Externí odkaz:
https://doaj.org/article/5752904709a143308c40896bb53cd2b9
Publikováno v:
International Applied Mechanics. 53:59-66
The nonlinear dynamics of a tank partially filled with a fluid for the generalized Faraday problem is studied. The classical Faraday problem is generalized in two ways: (i) the mechanical system is allowed to translate in a horizontal plane, which is
Publikováno v:
International Applied Mechanics. 52:599-604
The nonlinear dynamics of a mechanical system consisting of a cylindrical tank partially filled with a fluid for the generalized Faraday problem is studied. Unlike the classical Faraday problem, the tank can undergo transverse horizontal motion, whic
Autor:
Valeriy M. Yashchuk, Kateryna I. Kovalyuk, G. V. Klishevich, Igor Dubey, V. I. Mel’nik, Olesya I. Batsmanova, Vladislav Yu. Kudrya
Publikováno v:
Molecular Crystals and Liquid Crystals. 639:151-159
Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optic...
The classical Faraday problem about parametrical oscillations of liquid in the vertically oscillating cylindrical reservoir includes strict vertical motion of the reservoir only in vertical direction. Generalization of the classical Faraday problem i
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::1e237f63101014ac145fb01cefe84565
https://ela.kpi.ua/handle/123456789/54965
https://ela.kpi.ua/handle/123456789/54965