Zobrazeno 1 - 8
of 8
pro vyhledávání: '"TYMV, turnip yellow mosaic virus"'
Publikováno v:
The Journal of Biological Chemistry
Marafiviruses are capable of persistent infection in a range of plants that have importance to the agriculture and biofuel industries. Although the genomes of a few of these viruses have been studied in-depth, the composition and processing of the po
Publikováno v:
Journal of Molecular Biology
Journal of Molecular Biology, 429(22), 3441-3470
Journal of Molecular Biology, 429(22), 3441-3470
Post-translational modification of cellular proteins by ubiquitin regulates numerous cellular processes, including innate and adaptive immune responses. Ubiquitin-mediated control over these processes can be reversed by cellular deubiquitinating enzy
Autor:
Cornelis W.A. Pleij
Publikováno v:
Current Opinion in Structural Biology
Many new RNA pseudoknot structures have been detected and proposed in the past year. Although we are still waiting for the first detailed structure of a pseudoknot, their role in processes such as translational autoregulation or ribosomal frameshifti
Autor:
Michiels, Paul J.A, Versleijen, Alexandra A.M, Verlaan, Paul W, Pleij, Cornelis W.A, Hilbers, Cornelis W, Heus, Hans A
Publikováno v:
Journal of Molecular Biology
RNA pseudoknots play important roles in many biological processes. In the simian retrovirus type-1 (SRV-1) a pseudoknot together with a heptanucleotide slippery sequence are responsible for programmed ribosomal frameshifting, a translational recoding
Publikováno v:
Biochimie
The genomic RNA from turnip yellow mosaic virus presents a 3'-end functionally and structurally related to tRNAs. This report summarizes our knowledge about the peculiar structure of the tRNA-like domain and its interaction with tRNA specific protein
Autor:
Eric Westhof, Luc Jaeger
Publikováno v:
Current Opinion in Structural Biology
RNA pseudoknots result from Watson-Crick base pairing involving a stretch of bases located between paired strands and a distal single-stranded region. Recently, significant advances in our understanding of their structural and functional aspects have
Publikováno v:
Journal of Molecular Biology
The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imi
Publikováno v:
FEBS Letters
Febs Letters
Febs Letters
An increasing number of examples of translational regulation at the level of termination has been recently reported in eukaryotes. This paper reviews our present knowledge on this topic and proposes an understanding of these regulations by relating t