Zobrazeno 1 - 10
of 107
pro vyhledávání: '"SIMONA DE MARINO"'
Autor:
Claudia Finamore, Simona De Marino, Chiara Cassiano, Giuliano Napolitano, Pasquale Rapacciuolo, Silvia Marchianò, Michele Biagioli, Rosalinda Roselli, Cristina Di Giorgio, Carmen Festa, Stefano Fiorucci, Angela Zampella
Publikováno v:
Frontiers in Chemistry, Vol 12 (2024)
BAR502, a bile acid analogue, is active as dual FXR/GPBAR1 agonist and represents a promising lead for the treatment of cholestasis and NASH. In this paper we report the synthesis and the biological evaluation of a library of hybrid compounds prepare
Externí odkaz:
https://doaj.org/article/66a1ede6d3ce454db68ec5a259f39f5f
Publikováno v:
Marine Drugs, Vol 21, Iss 5, p 291 (2023)
The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloid
Externí odkaz:
https://doaj.org/article/05fdc1de879e4950aa0e99e7a554b0c6
Autor:
Claudia Finamore, Carmen Festa, Bianca Fiorillo, Francesco Saverio Di Leva, Rosalinda Roselli, Silvia Marchianò, Michele Biagioli, Lucio Spinelli, Stefano Fiorucci, Vittorio Limongelli, Angela Zampella, Simona De Marino
Publikováno v:
Molecules, Vol 28, Iss 6, p 2840 (2023)
Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the ant
Externí odkaz:
https://doaj.org/article/57b8d4d3cd4f4f31904254ee4e63efd5
Autor:
Simona De Vita, Claudia Finamore, Maria Giovanna Chini, Gabriella Saviano, Vincenzo De Felice, Simona De Marino, Gianluigi Lauro, Agostino Casapullo, Francesca Fantasma, Federico Trombetta, Giuseppe Bifulco, Maria Iorizzi
Publikováno v:
Plants, Vol 11, Iss 13, p 1671 (2022)
Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ9-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ9-THC level and is a valuabl
Externí odkaz:
https://doaj.org/article/62228aafb636416eafb2e505de1fd010
Autor:
Carmen Festa, Veronica Esposito, Daniela Benigno, Simona De Marino, Angela Zampella, Antonella Virgilio, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 23, Iss 3, p 1092 (2022)
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-brom
Externí odkaz:
https://doaj.org/article/2b394629f4044945bcb2a933f0a5f1ee
Autor:
Elisabetta Buommino, Simona De Marino, Martina Sciarretta, Marialuisa Piccolo, Carmen Festa, Maria Valeria D’Auria
Publikováno v:
Antibiotics, Vol 10, Iss 10, p 1258 (2021)
Staphylococcusaureus is an important opportunistic pathogen that causes many infections in humans and animals. The inappropriate use of antibiotics has favored the diffusion of methicillin-resistant S. aureus (MRSA), nullifying the efforts undertaken
Externí odkaz:
https://doaj.org/article/22c6629a285e474488e4b09e0cb83c0c
Autor:
Simona De Vita, Maria Giovanna Chini, Gabriella Saviano, Claudia Finamore, Carmen Festa, Gianluigi Lauro, Simona De Marino, Roberto Russo, Carmen Avagliano, Agostino Casapullo, Antonio Calignano, Giuseppe Bifulco, Maria Iorizzi
Publikováno v:
Biomolecules, Vol 11, Iss 10, p 1490 (2021)
Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from Gentiana lutea L. by means of computational techniques and in vitro assays. The two molecules (loganic
Externí odkaz:
https://doaj.org/article/c6a57e78b18740cc9a8bc91af190cfaa
Autor:
Katja-Emilia Lillsunde, Carmen Festa, Harshada Adel, Simona De Marino, Valter Lombardi, Supriya Tilvi, Dorota A. Nawrot, Angela Zampella, Lisette D'Souza, Maria Valeria D'Auria, Päivi Tammela
Publikováno v:
Marine Drugs, Vol 12, Iss 7, Pp 4045-4068 (2014)
Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances for their bioactive properties in a cell-based Chikungunya virus (CHIKV) replicon model and
Externí odkaz:
https://doaj.org/article/5415f3c23c284af78bc25e87baa5fbee
Autor:
Valentina Sepe, Francesco Saverio Di Leva, Claudio D'Amore, Carmen Festa, Simona De Marino, Barbara Renga, Maria Valeria D'Auria, Ettore Novellino, Vittorio Limongelli, Lisette D'Souza, Mahesh Majik, Angela Zampella, Stefano Fiorucci
Publikováno v:
Marine Drugs, Vol 12, Iss 6, Pp 3091-3115 (2014)
In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, ac
Externí odkaz:
https://doaj.org/article/1e51f3ccc1bb42a4b9953340a1958f82
Autor:
Seyed Mostafa Goldansaz, Carmen Festa, Ester Pagano, Simona De Marino, Claudia Finamore, Olga Alessandra Parisi, Francesca Borrelli, Ali Sonboli, Maria Valeria D’Auria
Publikováno v:
Molecules, Vol 24, Iss 9, p 1684 (2019)
The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided
Externí odkaz:
https://doaj.org/article/1d742846dd3345eb9dc18b0593a52a40