Zobrazeno 1 - 10
of 10
pro vyhledávání: '"Mawethu Pascoe Bilibana"'
Autor:
Mawethu Pascoe Bilibana, Marimuthu Citartan, Xolile Fuku, Abongile Nwabisa Jijana, Penny Mathumba, Emmanuel Iwuoha
Publikováno v:
Ecotoxicology and Environmental Safety, Vol 232, Iss , Pp 113249- (2022)
Purification and detection of algal toxins is the most effective technique to ensure that people have clean and safe drinking water. To achieve these objectives, various state-of-the-art technologies were designed and fabricated to decontaminate and
Externí odkaz:
https://doaj.org/article/7fc1e831de8f4004a9b762b3c4e6c495
Autor:
Mawethu Pascoe Bilibana, Marimuthu Citartan, Tzi Shien Yeoh, Timofey S. Rozhdestvensky, Thean-Hock Tang
Publikováno v:
Journal of Nucleic Acids, Vol 2017 (2017)
The binding specificity and affinity of aptamers have long been harnessed as the key elements in the development of aptamer-based assays, particularly aptasensing application. One promising avenue that is currently explored based on the specificity a
Externí odkaz:
https://doaj.org/article/0f8855baafb8475fbd984c30b78243bf
Autor:
Mawethu Pascoe Bilibana, Marimuthu Citartan, Xolile Fuku, Abongile Nwabisa Jijana, Penny Mathumba, Emmanuel Iwuoha
Publikováno v:
Ecotoxicology and Environmental Safety, Vol 232, Iss, Pp 113249-(2022)
Purification and detection of algal toxins is the most effective technique to ensure that people have clean and safe drinking water. To achieve these objectives, various state-of-the-art technologies were designed and fabricated to decontaminate and
Publikováno v:
Processes, Vol 9, Iss 179, p 179 (2021)
Processes
Volume 9
Issue 1
Processes
Volume 9
Issue 1
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
Autor:
Mawethu Pascoe Bilibana, Timofey S. Rozhdestvensky, Ewe Seng Ch'ng, Bakhtiar A. Bukari, Thean-Hock Tang, Marimuthu Citartan
Publikováno v:
Histochemistry and Cell Biology. 147:545-553
Antibodies have been the workhorse for diagnostic immunohistochemistry to specifically interrogate the expression of certain protein to aid in histopathological diagnosis. This review introduces another dimension of histochemistry that employs aptame
Autor:
Tzi Shien Yeoh, Mawethu Pascoe Bilibana, Timofey S. Rozhdestvensky, Thean-Hock Tang, Marimuthu Citartan
Publikováno v:
Journal of Nucleic Acids, Vol 2017 (2017)
Journal of Nucleic Acids
Journal of Nucleic Acids
The binding specificity and affinity of aptamers have long been harnessed as the key elements in the development of aptamer-based assays, particularly aptasensing application. One promising avenue that is currently explored based on the specificity a
Autor:
Mawethu Pascoe Bilibana, Robert Tshikhudo, Nazeem Jaheed, Nurali Mohamed, Njagi Njomo, Abebaw Tsegaye, Hlamulo Makelane, Oluwakemi Tovide, Avril Williams, Emmanuel I. Iwuoha, Ezo Nxusani, Sibulelo Vilakazi, Christopher E. Sunday, Rachel Fanelwa Ajayi, Priscilla G. L. Baker
Publikováno v:
Electrochimica Acta. 128:138-148
A graphenated polyaniline/tungsten oxide (PANI/WO 3 /GR) nanocomposite sensor was prepared by electropolymerisation of a mixture of aniline monomer and tungsten oxide on a graphene-modified glassy carbon electrode (GCE). The PANI/WO 3 /GR/GCE nanocom
Autor:
Chinwe O. Ikpo, Avril Williams, Kerileng M. Molapo, Sibulelo Vilakazi, Robert Tshikhudo, Tesfaye Waryo, Priscilla G. L. Baker, Bulelwa Mpushe, Gertrude Fomo, Christopher E. Sunday, Sinazo Qakala, Gcineka Mbambisa, Emmanuel I. Iwuoha, Mawethu Pascoe Bilibana, Oluwakemi Tovide
Publikováno v:
Electrochimica Acta. 128:128-137
Charge transfer reactions of electroactive reagents in pure Nafion film are generally slow due to Nafion's compact nature and the poor diffusion of ionic species within the film. Cationic reagents, such as tris(bipyridine)ruthenium(II) ion ([Ru(bpy)3
Autor:
Candice Rassie, Lindsay Wilson, Mawethu Pascoe Bilibana, Abongile N. Jijana, Hlamulo Makelane, Priscilla G. L. Baker, Christopher E. Sunday, Nomaphelo Ntshongontshi, Avril R. Williams, Emmanuel I. Iwuoha, Milua Masikini
Publikováno v:
Sensors, Vol 16, Iss 11, p 1901 (2016)
Sensors (Basel, Switzerland)
Sensors; Volume 16; Issue 11; Pages: 1901
Sensors (Basel, Switzerland)
Sensors; Volume 16; Issue 11; Pages: 1901
A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II) salicylaldiimine metallodendrimer (SDD–Co(II)) doped with electro-synthesized silver nanoparticles (AgNPs) for microcystin-LR (L, l-leucine; R, l-arginine), or
Autor:
Samantha F. Douman, Emmanuel I. Iwuoha, Anovuyo Jonnas, Lindsay Wilson, Tesfaye Waryo, Milua Masikini, Ezo Nxusani, Christopher E. Sunday, Avril R. Williams, Sinazo Qakala, Priscilla G. L. Baker, Mawethu Pascoe Bilibana
Publikováno v:
Materials, Vol 9, Iss 4, p 273 (2016)
Materials
Materials; Volume 9; Issue 4; Pages: 273
Materials
Materials; Volume 9; Issue 4; Pages: 273
An impedimetric immunosensor for fumonisin B1 (FB1) was developed from a poly(2,5-dimethoxyaniline)-multi-walled carbon nanotube (PDMA-MWCNT) composite on the surface of glassy carbon electrode (GCE). The composite was prepared electrochemically and