Zobrazeno 1 - 10
of 63
pro vyhledávání: '"M. Aldersley"'
Publikováno v:
BioTechniques, Vol 23, Iss 2, Pp 274-279 (1997)
We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection
Externí odkaz:
https://doaj.org/article/21190bff9c074040be72558dc4e6097b
Autor:
S. Abiru, John F. Dillon, Yasuhiro Miyake, Piero Portincasa, Giancarlo Spinzi, R. Harvey, T. Ngatchu, Agostino Colli, M. Taniai, K. Flahive, Masanori Abe, B. Hoeroldt, S. Holder, Howard Curtis, María Isabel Colombo, C. MacNicol, Gang Xie, Andrew Chilton, H. Hussaini, Cristina Rigamonti, M. Kato, Shintaro Yagi, G. Abouda, D. Tyrer, Chris D. Evans, Christopher I. Amos, K. Koss, Kazuaki Chayama, P. Premchand, K. Migita, Simon Panter, Marco Marzioni, Silvia Colombo, Konstantinos N. Lazaridis, M. Yagura, Ashley Brown, D. Gocher, Domenico Alvaro, K. Murata, Mark Wright, Piero Luigi Almasio, C. Healey, A. Ciaccio, N. Wheatley, Vincenzo Cardinale, T. Delahooke, Chiara Milani, T. Shewan, W. Stableforth, S. Levi, Mark L. Green, James V. Jones, Y. Baird, Aftab Ala, Burroughs Ak, D. Williams, K. Ario, P. Sanghi, Hemant Gupta, P. Southern, L. Farrington, M. Hamilton, Andrew D. Higham, I. Yabuuchi, H. Yatsuhashi, Lorenzo Morini, T. Yamamoto, Douglas Thorburn, M. Carnahan, N. Nishida, Susan Slininger, M. Koga, K. Honda, Annarosa Floreani, Andrew Douglass, K. Netherton, M. Yasunami, Hirohito Tsubouchi, F. Donato, K. Walker, U. Shmueli, Paolo Muratori, Ray Mathew, J. Maiden, E. Dungca, Subramaniam Ramakrishnan, S. Vyas, Helen Sweeting, Subrata Saha, T. Komeda, T. Komatsu, H. J. Lee, Maria Consiglia Bragazzi, T. Komura, C. Thomas, C. Shallcross, C. Duggan, J. Kordula, F. Muscariu, Lourdes Cumlat, Imran Patanwala, Giulia Cardamone, L. Morgan, J. Brighton, Masao Honda, H. Nakamura, David Jones, Raj Srirajaskanthan, M. E. Gershwin, T. Muro, L. Stafford, N. Fukushima, Graham P. Butcher, Andrea Crosignani, George Lipscomb, K. Hirata, Y. Nagaoki, S. Mann, Paul G. Richardson, David A Elphick, M. Mupudzi, Y. Ohara, E. Grieve, Gayle Clifford, Claudio Tiribelli, M. Quinn, G. Van Duyvenvoorde, E. Archer, Tatsuki Ichikawa, J. Maltby, T. Arinaga-Hino, Simon Williams, A. King, Yasuni Nakanuma, H. Doyle, A. Brind, Nora Cazzagon, H. Ota, Daphne D’Amato, K. Hogben, H. Wooldridge, J. Wilkins, Shuichi Kaneko, L. Hankey, Gordon Wood, Andrew Fraser, K. Martin, A. Naqvi, M. Ninkovic, M. Patel, Yoshihiko Maehara, Kapil Kapur, I. Amey, Vincenza Calvaruso, Kenichi Harada, T. Yamashita, James Neuberger, N. Taylor, T. Lee, J. Featherstone, C. Lawlor, K. Seward, Satoshi Yamagiwa, Andrea Galli, L. Tan, Kentaro Kikuchi, K. Furuta, Mark A. Ainsworth, Hiromasa Ohira, Esther Unitt, Yosuke Kawai, N. Lancaster, D. Simpson, R. Shidrawi, I. Salam, A.J. Bell, Pietro Andreone, J. Ishida, Voi Shim Wong, N Fisher, Andrew C. Douds, R. Penn, Matthew Foxton, A. Watson, Andrew Mason, S. Walsh, Hiromi Ishibashi, Daniel M. Forton, Giovanni Casella, H. Takaki, K. Yamauchi, Pietro Lampertico, Osamu Yokosuka, M. Koda, M. Davies, H. Mitchison, P. Gyawali, G. Bird, M. Hughes, L. Jones, C. Hamilton, A. Hynes, R. Galaska, Fabio Marra, Debasish Das, C. Cowley, A. Fouracres, Yasuhiko Sugawara, E. Mita, T. Saoshiro, Akinobu Taketomi, Robert P. Myers, R. Przemioslo, F. Wright, L. Hobson, L. Currie, J. Allison, J. Hails, Noriyo Yamashiki, Massimo Zuin, C. Grimley, Alessio Gerussi, S. Besley, Stefano Duga, A. Piotrowicz, H. Kouno, L. Dali-kemmery, H. Sakai, M. Mizokami, Stefano Fagiuoli, Amy Davis, Pier Maria Battezzati, Masao Nagasaki, Luigi Muratori, A. Mori, S. Desmennu, S. Jones, R. Abrahams, Keith George, F. Makita, J. Brown, D. Gorard, Satoru Joshita, M. Mills, Pierluigi Toniutto, S. Campbell, J. Butterworth, S. Dyer, Filomena Morisco, Norihiro Kokudo, T. Yapp, C. Shorrock, Floriano Rosina, E. Walker, Shinji Uemoto, H. Takahashi, Simon M. Rushbrook, K. Amor, E. Marshall, J. Browning, S. Batham, Luca Fabris, Paul R. Banim, Meenakshi Narain, M. Harada, Dermot Gleeson, N. Hirashima, M. Kikuchi, T. Nikami, Gideon M. Hirschfield, Carlo Ferrari, G. Prasad, O. Chirag, Katsushi Tokunaga, M. Nasseri, Rosanna Asselta, Y. Lu, Ken Shirabe, D. Sirdefield, George F. Mells, K. Sugi, R. Ayres, G. Whatley, A. Singhal, M. Leoni, N. Sivaramakrishnan, T. Harding, Rupert Ransford, Anton V J Gunasekera, C. Mulvaney-Jones, D. Ramanaden, M. Mendall, Muhammad F. Dawwas, Dave Jones, Luca Valenti, Earl J. Williams, Markus Gess, Peter Bramley, A. McNair, E. Hashimoto, P. Townshend, C. Ford, Mario Strazzabosco, Luca Miele, Matthew J Brookes, J. Colley, Mark Wilkinson, H. Dewhurst, Charles Millson, E. Shpuza, Shinji Shimoda, T. Himoto, P. Kitchen, M. Nakamuta, Hiroaki Nishimura, Martin Lombard, Kevork M. Peltekian, M. Pitcher, G. Lim, L. Graves, C. Palmer, S. Lord, S. Katsushima, S. Tripoli, Andrew Austin, N. White, B. Grover, S. Congreave, M. Prince, Rebecca Jones, K. Hirano, A. Shepherd, Y. Mano, Michael A. Heneghan, Richard Sandford, L. O'Donohoe, Marco Carbone, S. A. Rolls, Patrick Goggin, M. L. Cowan, M. Crossey, A. Loftus, K. Young, Mesbah Rahman, Cameron N. Ghent, E. Nambela, M. Xiong, L. Grellier, Sunil Dolwani, Antonio Picciotto, Gill Watts, Alberto Mattalia, Elvezia Maria Paraboschi, J. Orpe, Takeji Umemura, Yuki Hitomi, Fiona H. Gordon, Shotaro Sakisaka, A. Dias, Chin Lye Ch'ng, M. Carter, A. Mandal, Yufang Shi, Takafumi Ichida, N. Masaki, M. Oblak, S. Nagaoka, Kevin Yoong, O. Gervais, Minoru Nakamura, Kazuhiko Nakao, S. Taylor-Robinson, L. Kent, Sushma Saksena, A. Affronti, K. Boulton, R. Ede, H. Pateman, K. Yoshizawa, G. Bray, H. Ebinuma, Yeng Ang, Akio Ido, John Ramage, Richard Sturgess, C. Gray, E. Durant, M. Hayes, A. Saeed, J. Keggans, J. Gitahi, T. Valliani, Edoardo G. Giannini, C. Foale, A. Palegwala, Lory Saveria Crocè, K. Matsushita, S. Shaukat, J. Mclindon, S. Pearson, A. Barnardo, A. Wright, Mirko Tarocchi, R Marley, M. Kent, C. Dickson, A. Gibbins, J. Whiteman, S. Singhal, Richard Aspinall, M. Ito, Laura Cristoferi, Maurizia Rossana Brunetto, J. Booth, A. Bathgate, Morikazu Onji, A. Grant, A. Paton, Y. Aiba, P. Chan, J. Sayer, S. Whalley, T. Mathialahan, J. Gotto, T. Kanda, B. Williams, K. Elliott, P. Raymode, Akinobu Takaki, V. Silvestre, I. Gee, C. Hovell, Graham R. Foster, D. Cotterill, G. Stansfield, Grazia Anna Niro, J. Conder, Yoshiyuki Ueno, A. Shah, Jane Metcalf, S. Hayashi, T. Sato, S. Jain, J. Subhani, Donatella Barisani, A. McKay, Kuniaki Arai, Jeremy Shearman, Torao Tanaka, S. Glenn, S. E. O'Donnell, Federica Malinverno, Denise O'Donnell, R. Casey, N. Sharer, J. Bowles, J. Kendall, Maria Cristina Vinci, Antonio Benedetti, George MacFaul, K. Houghton, Vincenzo Ronca, P. Desousa, B. Holbrook, F. Ali, B. Longhurst, Atsushi Tanaka, Marek Czajkowski, R. Tang, Kazuhide Yamamoto, Y. Watanabe, Graeme J.M. Alexander, R. Cloudsdale, F. Hines, M. Karmo, Brian D. Juran, I. Gooding, Y. Takeyama, J. Fraser, A. Mukhopadhya, Sumihito Tamura, Hajime Takikawa, R. Damant, E. Wilhelmsen, M. Kobayashi, J. Tregonning, V. Lambourne, D. Clement, D. Braim, M. Shimada, S. Sen, Shaun Greer, C. Innes, E. Gunter, C. Brown, H. Klass, A. Komori, Andy Li, H. Fairlamb, N. Ncube, Yoshinori Shimada, M. Harrison, S. Marriott, I. Grattagliano, Savino Bruno, A. Naganuma, Xiangjun Gu, Michael F. Seldin, S. Thornthwaite, Peter R. Mills, Katherine A. Siminovitch, X. Liu, Masataka Seike, J. Curtis, Carmela Cursaro, Z. Li, Mikio Zeniya, K. Warner, B. Bird, Jane Collier, Bridget Gunson, S. Tsuruta, E. Tanqueray, Richard Evans, H. Kamitsukasa, R. Sugimoto, Jeremy Tibble, D. Neal, S. Ducker, Francesco Azzaroli, K. Spurdle, K. Ocker, M. Senju, C. Collins, Y. Nakamura, Matthew E. Cramp, Yuji Soejima, I. Drake, K. Ueno, T. Mannami, Clara Mancuso, M. Kawashima, M. Cox, S. S. Kohn, H. Shibata, Stephen D. Ryder, Christopher Macdonald, J. Ridpath, Stephen P. Pereira, L. March, Barbara Coco, J. Morrison, A. Broad, J. Verheyden, Angelo Andriulli, N. Higuchi, J. Musselwhite, R. Bishop, Gwen Baxter, Richard A. Miller, Guido Colloredo, A. Eastick, I. Rees, Deb Ghosh, L. Winter, Sara Massironi, R. McCorry, Gianfranco Elia, T. Kobata, N. Naeshiro, K. Pollock, J. Gasem, S. Gallagher, K. Jing, S. Misra, B. Shinder, Harriet Gordon, E. Takesaki, J. Sadeghian, S. Tsunematsu, Ana Lleo, M. Aldersley, Elizabeth J. Atkinson, Pietro Invernizzi, Heather J. Cordell
Publikováno v:
Gastroenterology
2495.e26
2495.e26
Background & aims: Genome-wide association studies in primary biliary cholangitis (PBC) have failed to find X chromosome (chrX) variants associated with the disease. Here, we specifically explore the chrX contribution to PBC, a sexually dimorphic com
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::f572a51721e331b6b434cfe52472b56b
https://hdl.handle.net/11380/1288074
https://hdl.handle.net/11380/1288074
Autor:
John McLauchlan, Kosh Agarwal, Paul Richardson, William L. Irving, Douglas C. MacDonald, Ana da Silva Filipe, Joseph Hughes, Elihu Aranday-Cortes, Andrew Ustianowski, E. Thomson, William Rosenberg, Graham R. Foster, Vattipally B. Sreenu, M. Aldersley, Martin Wiselka
Publikováno v:
Journal of Hepatology. 68:864-866
No abstract available.
Autor:
Mette Vesterhus, Simon M. Rushbrook, Richard Sandford, Kate D. Lynch, Douglas Thorburn, George F. Mells, William Gelson, Edit Castren, Gideon M. Hirschfield, Palak J. Trivedi, Roger W. Chapman, Sun-Gou Ji, M. Aldersley, Mark Hudson, Michael A. Heneghan, Andrew Bathgate, Graeme J.M. Alexander, Brijesh Srivastava, Martine Walmsley, Carl A. Anderson, Tom H. Karlsen, Allan Clark, Elizabeth C. Goode, Kelly Spiess
Publikováno v:
Hepatology (Baltimore, Md.)
We sought to identify factors that are predictive of liver transplantation or death in patients with primary sclerosing cholangitis (PSC), and to develop and validate a contemporaneous risk score for use in a real-world clinical setting. Analyzing da
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::009bc10d71818fe7136a6946aee51c25
https://ora.ox.ac.uk/objects/uuid:2ce133cc-7d74-4380-bf6b-688baf54520b
https://ora.ox.ac.uk/objects/uuid:2ce133cc-7d74-4380-bf6b-688baf54520b
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
Olorunda Rotimi, John Hutchinson, Stuart McPherson, M. Aldersley, Dina Tiniakos, Jessica K Dyson, Laura Harrison, Graham R. Foster
Publikováno v:
Journal of Hepatology. 64:234-238
Hepatitis C virus (HCV) infection is a major cause of end-stage liver disease and hepatocellular carcinoma. There have been rapid advances in HCV treatment with the development of oral direct-acting antivirals (DAAs). Studies have shown sustained vir
Autor:
William Gelson, Stuart McPherson, Andrew Bathgate, Douglas MacDonald, Arash Vaziri, Kosh Agarwal, Alexander Gimson, David Mutimer, M. Aldersley
Publikováno v:
Journal of viral hepatitis. 26(2)
Following the introduction of direct-acting antivirals (DAA), there have been reports of declining incidence of hepatitis C (HCV)-related liver disease as a liver transplantation indication. In this study, we assessed the impact of DAA on liver trans
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
David Mutimer, Graham R. Foster, William L. Irving, Kosh Agarwal, M. Aldersley, Michelle Cheung, Andrew J. Leigh Brown
Publikováno v:
Journal of Hepatology. 68:S109-S110
Autor:
Stefan G. Hübscher, Rachel M. Brown, G. Abouda, Philip N. Newsome, M. Aldersley, Stephen C. L. Gough, Matthew J. Armstrong, Kathy Guo, Deborah D. Stocken, Jeremy W. Tomlinson, Piers Gaunt, Richard D. Parker, Guruprasad P. Aithal, Darren Barton, Diana Hull, Jonathan Hazlehurst
Summary Background Glucagon-like peptide-1 (GLP-1) analogues reduce hepatic steatosis, concentrations of liver enzymes, and insulin resistance in murine models of fatty liver disease. These analogues are licensed for type 2 diabetes, but their effica
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::cd7be55e266d1f2c011415e130352061
http://eprints.nottingham.ac.uk/39309/
http://eprints.nottingham.ac.uk/39309/