Zobrazeno 1 - 10
of 10
pro vyhledávání: '"Kyung-Mi Song"'
Publikováno v:
Sensors, Vol 12, Iss 1, Pp 612-631 (2012)
Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we prese
Externí odkaz:
https://doaj.org/article/3bd7e8b63cfa498c818dbb20d4c73fd7
Autor:
Kyung-Mi Song1 kmsong@postech.ac.kr, Seonghwan Lee1 s.lee@postech.ac.kr, Changill Ban1 ciban@postech.ac.kr
Publikováno v:
Sensors (14248220). 2012, Vol. 12 Issue 1, p612-631. 20p. 12 Diagrams, 2 Charts.
Autor:
Jong-Bong Lee, Richard Fishel, Minhyeok Chang, Won-Ki Cho, Cherlhyun Jeong, Jeungphill Hanne, Changill Ban, Kyung-Mi Song, Daehyung Kim
Publikováno v:
Structure. 20:1264-1274
SummaryThe mismatch repair (MMR) initiation protein MutS forms at least two types of sliding clamps on DNA: a transient mismatch searching clamp (∼1 s) and an unusually stable (∼600 s) ATP-bound clamp that recruits downstream MMR components. Rema
Publikováno v:
Biosensors and Bioelectronics. 35:291-296
Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria,
Publikováno v:
Biosensors and Bioelectronics. 33:113-119
A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A si
Autor:
Sangyong Jon, Yang-Sook Chun, Won Jong Kim, Kyung-Mi Song, Changill Ban, Minseon Cho, Hunho Jo, Kyoungin Min
Publikováno v:
Biomaterials. 32:2124-2132
We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells
Publikováno v:
Bulletin of the Korean Chemical Society. 32:247-250
We designed an effective screening method for double strand DNA (dsDNA) binders using DNA-modified magnetic particles. Hairpin DNA was immobilized on the surface of magnetic particle for a simple screening of dsDNA binding materials in a solution con
Publikováno v:
Scripta Materialia. 44:2047-2050
Publikováno v:
Analytical and bioanalytical chemistry. 402(6)
A gold nanoparticle based dual fluorescence–colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers,
Autor:
Hunho Jo, Min Su Han, Kyung-Mi Song, Kyoungin Min, Changill Ban, Sung Ho Jeon, Ja Kang Ku, Minseon Cho, Taisun Kim
Publikováno v:
Analytical biochemistry. 415(2)
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for k