Zobrazeno 1 - 9
of 9
pro vyhledávání: '"Kyoungin Min"'
Autor:
Jaeyoon Kim, Jang Ho Joo, Juhyun Kim, Heena Rim, Jae young Shin, Yun-Ho Choi, Kyoungin Min, So Young Lee, Seung-Hyun Jun, Nae-Gyu Kang
Publikováno v:
Current Issues in Molecular Biology, Vol 46, Iss 10, Pp 11207-11219 (2024)
Platycladus orientalis is a traditional oriental herbal medicinal plant that is widely used as a component of complex prescriptions for alopecia treatment in Eastern Asia. The effect of PO on hair growth and its underlying mechanism, however, have no
Externí odkaz:
https://doaj.org/article/e8cbeaa7d28d469a87f171c3e58725d8
Publikováno v:
Current Issues in Molecular Biology, Vol 46, Iss 8, Pp 9136-9148 (2024)
Skin healing occurs through an intricate process called wound healing which comprises four phases: coagulation and hemostasis, inflammation, cellular proliferation, and remodeling. Chronic wounds often arise because of prolonged or excessive inflamma
Externí odkaz:
https://doaj.org/article/33698d8f61764295859f21e070c8f6bd
Publikováno v:
BIODESIGN. 10:23-28
Autor:
Sangyong Jon, Yang-Sook Chun, Won Jong Kim, Kyung-Mi Song, Changill Ban, Minseon Cho, Hunho Jo, Kyoungin Min
Publikováno v:
Biomaterials. 32:2124-2132
We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells
Publikováno v:
Bulletin of the Korean Chemical Society. 32:247-250
We designed an effective screening method for double strand DNA (dsDNA) binders using DNA-modified magnetic particles. Hairpin DNA was immobilized on the surface of magnetic particle for a simple screening of dsDNA binding materials in a solution con
Publikováno v:
Analytical biochemistry. 421(1)
We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence
Autor:
Hunho Jo, Min Su Han, Kyung-Mi Song, Kyoungin Min, Changill Ban, Sung Ho Jeon, Ja Kang Ku, Minseon Cho, Taisun Kim
Publikováno v:
Analytical biochemistry. 415(2)
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for k
Publikováno v:
Chemical communications (Cambridge, England). 46(30)
Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (−) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.
Publikováno v:
Biosensorsbioelectronics. 23(12)
Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IF