Zobrazeno 1 - 10
of 95
pro vyhledávání: '"Koenig, Erik"'
Autor:
Mulligan, George, Lichter, David I., Di Bacco, Alessandra, Blakemore, Stephen J., Berger, Allison, Koenig, Erik, Bernard, Hugues, Trepicchio, William, Li, Bin, Neuwirth, Rachel, Chattopadhyay, Nibedita, Bolen, Joseph B., Dorner, Andrew J., van de Velde, Helgi, Ricci, Deborah, Jagannath, Sundar, Berenson, James R., Richardson, Paul G., Stadtmauer, Edward A., Orlowski, Robert Z., Lonial, Sagar, Anderson, Kenneth C., Sonneveld, Pieter, San Miguel, Jesús F., Esseltine, Dixie-Lee, Schu, Matthew
Publikováno v:
In Blood 30 January 2014 123(5):632-639
Autor:
Milhollen, Michael A., Thomas, Michael P., Narayanan, Usha, Traore, Tary, Riceberg, Jessica, Amidon, Benjamin S., Bence, Neil F., Bolen, Joseph B., Brownell, James, Dick, Lawrence R., Loke, Huay-Keng, McDonald, Alice A., Ma, Jingya, Manfredi, Mark G., Sells, Todd B., Sintchak, Mike D., Yang, Xiaofeng, Xu, Qing, Koenig, Erik M., Gavin, James M., Smith, Peter G.
Publikováno v:
In Cancer Cell 20 March 2012 21(3):388-401
Autor:
Milhollen, Michael A. *, Traore, Tary *, Adams-Duffy, Jennifer, Thomas, Michael P., Berger, Allison J., Dang, Lenny, Dick, Lawrence R., Garnsey, James J., Koenig, Erik, Langston, Steven P., Manfredi, Mark, Narayanan, Usha, Rolfe, Mark, Staudt, Louis M., Soucy, Teresa A., Yu, Jie, Zhang, Julie, Bolen, Joseph B., Smith, Peter G. *
Publikováno v:
In Blood 2 September 2010 116(9):1515-1523
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
Koenig, Erik, Allan, Mike
Publikováno v:
Iron & Steel Technology; Dec2023, Vol. 20 Issue 12, p78-82, 5p
Autor:
Koenig, Erik M.1 Erik.Koenig@Takeda.com, Fisher, Craig1, Bernard, Hugues1, Wolenski, Francis S.1, Gerrein, Joseph1, Carsillo, Mary1, Gallacher, Matt1, Tse, Aimy1, Peters, Rachel1, Smith, Aaron2, Meehan, Alexa1, Tirrell, Stephen1, Kirby, Patrick1
Publikováno v:
BMC Genomics. 8/17/2016, Vol. 17, p1-13. 13p. 1 Chart, 5 Graphs.
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
Koenig, Erik, Fisher, Craig, Bernard, Hugues, Wolenski, Francis, Gerrein, Joseph, Carsillo, Mary, Gallacher, Matt, Tse, Aimy, Peters, Rachel, Smith, Aaron, Meehan, Alexa, Tirrell, Stephen, Kirby, Patrick
List of 106 enriched miRNAs by tissue. miRNAs are annotated as tissue enriched (TE) or highly tissue enriched (HTE). The family of miRNA and mature miRNAs in dog, human and rat are given. (PDF 55Â kb)
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::c01df97266559ea3d044c13000b2b6e0
Autor:
Koenig, Erik, Fisher, Craig, Bernard, Hugues, Wolenski, Francis, Gerrein, Joseph, Carsillo, Mary, Gallacher, Matt, Tse, Aimy, Peters, Rachel, Smith, Aaron, Meehan, Alexa, Tirrell, Stephen, Kirby, Patrick
Benefit and need for enhanced annotations for miRNA studies. (A) Pancreas enriched miR-217-3p (rno-miR-217-3p AUCAGUUCCUAAUGCAUUGCCU) identified in the dog miRNA tissue atlas was found as a novel un-annotated human miRNA. It is conserved in rats, dog
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::0348d3cf6c46b6146436b650d761463b
Autor:
Smith, Aaron, Calley, John, Mathur, Sachin, Qian, Hui-Rong, Wu, Han, Farmen, Mark, Caiment, Florian, Bushel, Pierre, Jianying Li, Fisher, Craig, Kirby, Patrick, Koenig, Erik, Hall, David, Watson, David
qPCR of pancreas enriched miRNAs. Total RNA from the pancreas tissue of each individual rat was normalized by mass and examined by qPCR for expression of miRs-216a-5p, 375-3p and 148a-3p. Ct values are indicated on the Y-axis and the rat pancreas sam
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::5619cf31355d774505658c5f83918a83