Zobrazeno 1 - 6
of 6
pro vyhledávání: '"Jose Avila-Cervantes"'
Autor:
Julian Daniel Sunday Willett, Annie Gravel, Isabelle Dubuc, Leslie Gudimard, Ana Claudia dos Santos Pereira Andrade, Émile Lacasse, Paul Fortin, Ju-Ling Liu, Jose Avila Cervantes, Jose Hector Galvez, Haig Hugo Vrej Djambazian, Melissa Zwaig, Anne-Marie Roy, Sally Lee, Shu-Huang Chen, Jiannis Ragoussis, Louis Flamand
Publikováno v:
Communications Biology, Vol 7, Iss 1, Pp 1-13 (2024)
Abstract The persistence of SARS-CoV-2 despite the development of vaccines and a degree of herd immunity is partly due to viral evolution reducing vaccine and treatment efficacy. Serial infections of wild-type (WT) SARS-CoV-2 in Balb/c mice yield mou
Externí odkaz:
https://doaj.org/article/7e05d290e45d4f32a383ce6ae1b567f7
Autor:
Jose Avila-Cervantes, Hans C E Larsson
Publikováno v:
Evolution. 77:329-334
O’Dea et al. (2022) (Pleistocene sea level changes and crocodile population histories on the isthmus of panama: a comment on Avila-Cervantes et al. (2020). Evolution, 76(11), 2778–2783. https://doi.org/10.1111/evo.14610) question our hypothesis t
Autor:
Julian Daniel Sunday Willett, Annie Gravel, Isabelle Dubuc, Leslie Gudimard, Ana Claudia dos Santos Pereira Andrade, Émile Lacasse, Paul Fortin, Ju-Ling Liu, Jose Avila Cervantes, Jose Hector Galvez, Haig Hugo Vrej Djambazian, Melissa Zwaig, Anne-Marie Roy, Sally Lee, Shu-Huang Chen, Jiannis Ragoussis, Louis Flamand
The persistence of COVID-19 is partly due to viral evolution reducing vaccine and treatment efficacy. Serial infections of Wuhan-like SARS-CoV-2 in Balb/c mice yielded mouse-adapted strains with greater infectivity and mortality. We investigated if p
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::39def01c4e7d1876e7ca690a34b45f4e
https://doi.org/10.1101/2023.01.16.523994
https://doi.org/10.1101/2023.01.16.523994
Autor:
Jose Avila Cervantes
PCR amplification with Tfec set Exon 5 to genotype Piedball morph in Ball python (Python regius) LEFT PRIMER AACTCAGAGCACTCCATGACC RIGHT PRIMER CAGGTGTGCCCCTTTCATAA
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::ad55a1c97959ec0af336840e0854dc3d
https://doi.org/10.17504/protocols.io.3byl4jb78lo5/v1
https://doi.org/10.17504/protocols.io.3byl4jb78lo5/v1
Autor:
Jose Avila Cervantes
Protocol to extract DNA from Ball Python (Python regius) dry sheds using Phenol:Chloroform:Isoamyl Alcohol
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::567e0ab4c2192c1b85c6649091f20228
https://doi.org/10.17504/protocols.io.rm7vzb344vx1/v1
https://doi.org/10.17504/protocols.io.rm7vzb344vx1/v1
Autor:
Carlos Arias, W. Owen McMillan, Hans C. E. Larsson, Marta Vargas, Miryam Venegas-Anaya, Jose Avila‐Cervantes
Publikováno v:
Evolution; international journal of organic evolutionLITERATURE CITED. 75(2)
The final formation of the Central American Isthmus (CAI) about 3.5 million years ago altered global ocean circulation, connected North and South America terrestrial biotas, and established the Caribbean Sea. The nature of this event creates a natura