Zobrazeno 1 - 10
of 31
pro vyhledávání: '"Jason Fontana"'
Autor:
Jason Fontana, David Sparkman-Yager, Ian Faulkner, Ryan Cardiff, Cholpisit Kiattisewee, Aria Walls, Tommy G. Primo, Patrick C. Kinnunen, Hector Garcia Martin, Jesse G. Zalatan, James M. Carothers
Publikováno v:
Nature Communications, Vol 15, Iss 1, Pp 1-16 (2024)
Abstract Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for pro
Externí odkaz:
https://doaj.org/article/5e3002d716ec47ceb8dca2261e3ce3bb
Autor:
Jason Fontana, Chen Dong, Cholpisit Kiattisewee, Venkata P. Chavali, Benjamin I. Tickman, James M. Carothers, Jesse G. Zalatan
Publikováno v:
Nature Communications, Vol 11, Iss 1, Pp 1-11 (2020)
The use of CRISPRa in bacteria lacks predictive rules for identifying effective gRNA target sites. Here the authors define features of bacterial promoters that impose stringent requirements on effective sites.
Externí odkaz:
https://doaj.org/article/8cfc1e2448d44cdbb571ab03ba5acc85
Publikováno v:
Nature Communications, Vol 9, Iss 1, Pp 1-11 (2018)
The absence of effective gene activators in bacteria limits regulated expression programs. Here the authors design synthetic bacterial CRISPR-Cas transcriptional activators that can be used to construct multi-gene programs of activation and repressio
Externí odkaz:
https://doaj.org/article/4698bcb289ae4ad39b0b62c50044470c
Autor:
Roberta Lentini, Noël Yeh Martín, Michele Forlin, Luca Belmonte, Jason Fontana, Michele Cornella, Laura Martini, Sabrina Tamburini, William E. Bentley, Olivier Jousson, Sheref S. Mansy
Publikováno v:
ACS Central Science, Vol 3, Iss 2, Pp 117-123 (2017)
Externí odkaz:
https://doaj.org/article/3cf21118bb864bd8961c482e08430a6b
Publikováno v:
Nature Communications, Vol 9, Iss 1, Pp 1-1 (2018)
In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGAT
Externí odkaz:
https://doaj.org/article/495fd8fb626042c6b73dc60110c5192b
Autor:
Jesse G. Zalatan, James M. Carothers, Chen Dong, Widianti Sugianto, Jason Fontana, Cholpisit Kiattisewee, Pamela Peralta-Yahya
Publikováno v:
Metabolic Engineering. 66:283-295
CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed i
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::643a5e5a8bbd01de2ac06326a85f9827
https://doi.org/10.1016/j.ymben.2021.04.002
https://doi.org/10.1016/j.ymben.2021.04.002
Publikováno v:
Current Opinion in Biotechnology. 64:190-198
Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in ba
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::fe3d949f3d4545df38d6882376ef88fb
https://doi.org/10.1016/j.copbio.2020.04.005
https://doi.org/10.1016/j.copbio.2020.04.005
Autor:
Vincent Noireaux, Jesse G. Zalatan, Venkata P. Chavali, Aset Khakimzhan, Benjamin I. Tickman, James M. Carothers, Jason Fontana, Diego Alba Burbano, Cholpisit Kiattisewee
Publikováno v:
Cell Systems. 13:215-229.e8
Summary CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::1834324e5732a86e74cc8cfb0d3d62a8
https://doi.org/10.1016/j.cels.2021.10.008
https://doi.org/10.1016/j.cels.2021.10.008
Autor:
Jason Fontana, James M. Carothers, Aset Khakimzhan, Benjamin I. Tickman, Vincent Noireaux, David Garenne
Publikováno v:
Physical Biology. 18:056003
It is established that for CRISPR-Cas9 applications guide RNAs with 17-20 bp long spacer sequences are optimal for accurate target binding and cleavage. In this work we perform cell-free CRISPRa (CRISPR activation) and CRISPRi (CRISPR inhibition) exp
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::a558acbc68b336ab39e187bb005a6069
https://doi.org/10.1088/1478-3975/ac091e
https://doi.org/10.1088/1478-3975/ac091e
Autor:
Sheref S. Mansy, Sabrina Tamburini, Olivier Jousson, Michele Cornella, Laura Martini, Luca Belmonte, William E. Bentley, Michele Forlin, Jason Fontana, Roberta Lentini, Noël Yeh Martín
Publikováno v:
ACS Central Science, Vol 3, Iss 2, Pp 117-123 (2017)
ACS Central Science
ACS Central Science
Artificial cells capable of both sensing and sending chemical messages to bacteria have yet to be built. Here we show that artificial cells that are able to sense and synthesize quorum signaling molecules can chemically communicate with V. fischeri,
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::0cea3dbc3a7979b0703de1f01f967365
https://doi.org/10.1021/acscentsci.6b00330
https://doi.org/10.1021/acscentsci.6b00330