Zobrazeno 1 - 10
of 52
pro vyhledávání: '"Irina M. Russu"'
Autor:
Irina M. Russu, Yuegao Huang
Publikováno v:
Biochemistry. 56(19)
Nuclear magnetic resonance spectroscopy and proton exchange are being used to characterize the opening reactions of individual base pairs in the RNA-DNA hybrid 5'-rGCGAUAAAAAGGCC-3'/5'-dGGCCTTTTTATCGC-3'. The hybrid contains a central tract of five r
Autor:
Alicia E. Every, Irina M. Russu
Publikováno v:
Journal of Molecular Recognition. 26:175-180
8-oxoguanine is a major lesion of genomic DNA that results from oxidation of guanine by reactive oxygen species. The repair of this lesion is initiated by 8-oxoguanine glycosylases, which excise the damaged base by “flipping” it outside the DNA d
Publikováno v:
Biochemistry. 48:3988-3997
Nuclear magnetic resonance spectroscopy and proton exchange have been used to characterize two RNA-DNA hybrids from the tR2 intrinsic transcription terminator site of phage lambda. The hybrids have the same base sequence [5'-GGCGCAGGCC(T/U)(T/U)CC-3'
Publikováno v:
Biochemistry. 45:13606-13613
The sarcin-ricin domain is a universal element of the RNA from the large ribosomal subunit. The domain is part of the binding site for elongation factors and is specifically cleaved by the toxins alpha-sarcin and ricin. In this work, we have mapped t
Autor:
Irina M. Russu, Daniel Coman
Publikováno v:
Biophysical Journal. 89(5):3285-3292
The opening of basepairs plays a key role in DNA replication and transcription, and in the action of DNA repair and modification enzymes. In this article, we have used proton exchange to define the energetics of the pathways for basepair opening in t
Autor:
Daniel Coman, Irina M. Russu
Publikováno v:
Journal of Biological Chemistry. 280:20216-20221
DNA-unwinding elements are specific base sequences that are located in the origin of DNA replication where they provide the start point for strand separation and unwinding of the DNA double helix. In the present work we have obtained the first charac
Autor:
Daniel Coman, Irina M. Russu
Publikováno v:
Nucleic Acids Research. 32:878-883
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The r
Allosteric effects of chloride ions at the intradimeric ?1?1 and ?2?2 interfaces of human hemoglobin
Autor:
Irina M. Russu, Iulian N. Rujan
Publikováno v:
Proteins: Structure, Function, and Genetics. 49:413-419
The structural transition induced by ligand binding in human hemoglobin encompasses quaternary structure changes at the interfaces between the two alphabeta dimers. In contrast, the interfaces between alpha and beta subunits within the same dimer (i.
Autor:
Jie Zhang, Irina M. Russu
Publikováno v:
Biochemistry. 53(29)
The concatemer junction is a conserved sequence of 8 bp, which is strategically located at the junction between the head-to-tail repeats of genomic DNA in T7 and related bacteriophages. The RNA polymerase pauses at this site to recruit the machinery
Publikováno v:
Proceedings of the National Academy of Sciences. 98:3773-3777
Allosteric effects in hemoglobin arise from the equilibrium between at least two energetic states of the molecule: a tense state, T, and a relaxed state, R. The two states differ from each other in the number and energy of the interactions between he