Výsledky vyhledávání - "Francisco Javier Perea Díaz"

Akademický článek

Three Mexican Families with β thalassemia intermedia with different molecular basis

Autor: Lourdes del Carmen Rizo de la Torre, Francisco Javier Perea Díaz, Bertha Ibarra Cortés, Víctor Manuel Rentería López, Josefina Yoaly Sánchez López, Francisco Javier Sánchez Anzaldo, María Teresa Magaña Torres, Katia Gonnet, Catherine Badens, Nathalie Bonello-Palot

Publikováno v: Genetics and Molecular Biology, Vol 42, Iss 4 (2020)

Abstract Beta thalassemia (β-thal) is a frequent monogenic disease, is clinically and molecularly heterogeneous. This study described molecular and laboratory findings for three Mexican patients with β-thal intermedia phenotype and their relatives.

Externí odkaz: https://doaj.org/article/8588f34652d04c23b4a056d74528f0a5

Zobrazit plný text záznamu

Hematological and molecular analysis of patients with G6PD deficiency revealed coexistent hereditary spherocytosis and alpha thalassemia

Autor: L. C. Rizo-de-la-Torre, Rubiceli Hernández-Peña, Isis Mariela Herrera-Tirado, Francisco Javier Perea-Díaz, Bertha Ibarra-Cortés

Publikováno v: Annals of Human Genetics. 86:87-93

Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency, hereditary spherocytosis (HS), and alpha thalassemia (α-thal) are frequent erythrocyte pathologies with different geographic distributions worldwide. Our aim is to report hematological

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::5f7434e4756635dcb4e2d6a8bda690a5
https://doi.org/10.1111/ahg.12451

Zobrazit plný text záznamu

Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients

Autor: María Teresa Magaña-Torres, Josefina Yoaly Sánchez-López, Francisco Javier Perea-Díaz, Bertha Ibarra-Cortés, Víctor Manuel Rentería-López, Lourdes Del Carmen Rizo-de la Torre

Publikováno v: Genetic Testing and Molecular Biomarkers. 25:247-252

Introduction: Alpha- and beta-thalassemia are caused by reduced or absent synthesis of hemoglobin (Hb) subunits α and/or β. HBA2, HBA1, and HBB mutations are the main cause of thalassemias. The aim of this article is to analyze molecular and hemato

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::66253e5287d0dd8f394bf8324c9f2ea9
https://doi.org/10.1089/gtmb.2020.0276

Zobrazit plný text záznamu

Autosomal dominant early onset Alzheimer's disease in the Mexican state of Jalisco: High frequency of the mutation PSEN1 c. 1292C >A and phenotypic profile of patients

Autor: Francisco Javier Perea-Díaz, María Teresa Magaña-Torres, Luis E. Figuera, Sofia Dumois-Petersen, Martha Patricia Gallegos-Arreola, John M. Ringman

Publikováno v: American Journal of Medical Genetics Part C: Seminars in Medical Genetics. 184:1023-1029

Mutations in three genes (APP, PSEN1, and PSEN2) are the main cause of the autosomal dominant early-onset Alzheimer's disease (AD-EOAD). In PSEN1, the A431E (c.1292C>A, rs63750083) mutation is suspected to have exerted a founder effect in the State o

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_________::dda6696efc93f738e3312a3774861cdc
https://doi.org/10.1002/ajmg.c.31865

Zobrazit plný text záznamu

Three novelHBBmutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients

Autor: María Teresa Magaña-Torres, Francisco Javier Perea-Díaz, Josefina Yoaly Sánchez-López, Víctor Manuel Rentería-López, B. Ibarra, L. C. Rizo-de-la-Torre

Publikováno v: International Journal of Laboratory Hematology. 39:539-545

Introduction Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. Methods One hundred and forty-nine β-thal Me

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::3574851ddddafddbce9ddde9ffec9390
https://doi.org/10.1111/ijlh.12692

Zobrazit plný text záznamu

Plný text ve formátu HTML

A Novel 31.1 kb α-Thalassemia Deletion (– –MEX3) Found in a Mexican Family

Autor: Víctor Manuel Rentería-López, Francisco Javier Perea-Díaz, L. C. Rizo-de-la-Torre, Josefina Yoaly Sánchez-López, Bertha Ibarra-Cortés

Publikováno v: Hemoglobin. 41:180-184

α-Thalassemia (α-thal), a genetic disease characterized by microcytosis, hypochromia and anemia, is predominantly caused by deletions of the α-globin genes, HBA2 and HBA1. In this study, we describe a novel 31.1 kb α-thal deletion, - -MEX3 (NC_00

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_________::add0108a059c3dc8d0d546a0a63238de
https://doi.org/10.1080/03630269.2017.1356330

Zobrazit plný text záznamu

Plný text ve formátu HTML

DNA Variants Involved in Regulation of Fetal Hemoglobin in Mexican Patients with Sickle Cell Disease. a Preliminary Analysis

Autor: Martha Venegas, Francisco Javier Perea-Díaz, Laura Lucía Espinoza-Mata, Bertha Ibarra-Cortés, Efrain Aquino, Carmela Hernández-Carbajal, Lourdes Del Carmen Rizo-de la Torre

Publikováno v: Blood. 136:30-31

HbS (HBB:c.20A>T, beta 6 Glu>Val) is a frequent Hb variant in Mexico, in particular in some regions close to the Pacific and Atlantic Oceans, with carrier frequencies from 0.5 to 12.8%, therefore Sickle Cell Disease patients are often seen in those r

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_________::d404ae4aff15b4adefa6288abd6f8f3a
https://doi.org/10.1182/blood-2020-139812

Zobrazit plný text záznamu

Vyhledávací nástroje:

Upřesnit hledání