Zobrazeno 1 - 5
of 5
pro vyhledávání: '"E. N. Sinurat"'
Autor:
Efta Yudiarsah, E. N. Sinurat
Publikováno v:
IOP Conference Series: Materials Science and Engineering. 763:012061
Electron density of states and transmission probability of G4 DNA molecule have been calculated. The calculation was carried out on G4 DNA consists of 32 G-quartets. G4 DNA molecule is represented mathematically by using Hamiltonian tight binding mod
Autor:
E. N. Sinurat, Efta Yudiarsah
Publikováno v:
AIP Conference Proceedings.
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGC
I-V characteristics on G4 DNA molecule: Electric field and current dependent hopping amplitude model
Autor:
E. N. Sinurat, Efta Yudiarsah
Publikováno v:
IOP Conference Series: Materials Science and Engineering. 578:012023
We study the charge transport property of G4 DNA molecule by calculating the I-V characteristics at several temperatures. The G4 DNA we used consists of 32 G-tetrads built from four guanine bases and is contacted to metallic electrodes at both ends.
Autor:
Efta Yudiarsah, E. N. Sinurat
Publikováno v:
IOP Conference Series: Materials Science and Engineering. 496:012053
Autor:
E N Sinurat, E Yudiarsah
Publikováno v:
IOP Conference Series: Materials Science & Engineering; May2019, Vol. 496 Issue 1, p1-1, 1p