Výsledky vyhledávání - "Dimitri Bytchenkoff"

Construction of Banach frames and atomic decompositions of anisotropic Besov spaces

Autor: Dimitri Bytchenkoff

Publikováno v: Annali di Matematica Pura ed Applicata
Annali di Matematica Pura ed Applicata, Springer Verlag, In press, ⟨10.1007/s10231-020-01040-y⟩

We construct generalised shift-invariant systems of functions of several real variables for anisotropic Besov spaces that can be generated by the decomposition method using any given expansive matrix and establish the conditions on those systems unde

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::640e30f0f87e038b9a331145c578948d
https://hal.archives-ouvertes.fr/hal-02945015

Zobrazit plný text záznamu

Design and properties of wave packet smoothness spaces

Autor: Dimitri Bytchenkoff, Felix Voigtlaender

Publikováno v: Journal de Mathématiques Pures et Appliquées
Journal de Mathématiques Pures et Appliquées, Elsevier, 2020, 133, pp.185-262. ⟨10.1016/j.matpur.2019.05.006⟩
Journal de Mathématiques Pures et Appliquées, 2020, 133, pp.185-262. ⟨10.1016/j.matpur.2019.05.006⟩

We introduce a family of quasi-Banach spaces - which we call wave packet smoothness spaces - that includes those function spaces which can be characterised by the sparsity of their expansions in Gabor frames, wave atoms, and many other frame construc

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::420519cf2c1d6e16391617900de0280e

Zobrazit plný text záznamu

Extrapolation and phase correction of non-uniformly broadened signals

Autor: Dimitri Bytchenkoff, Stéphane Rodts

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2013, 233 (-), pp.64-73. ⟨10.1016/j.jmr.2013.05.003⟩

International audience; The initial part of FID-signals cannot always be acquired experimentally. This is particularly true for signals characterised by strong inhomogeneous broadening, such as those in porous materials, e.g. cements, soils and rocks

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::828104021d0599417cfc64295d8f8a56
https://doi.org/10.1016/j.jmr.2013.05.003

Zobrazit plný text záznamu

Cardinal series to restore NMR-signals dominated by strong inhomogeneous broadening

Autor: Dimitri Bytchenkoff, Stéphane Rodts

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2011, 212, pp.26-39. ⟨10.1016/j.jmr.2011.06.002⟩

International audience; We have devised two numerical methods of restoring incomplete band-limited NMR-signals to integrity by either interpolating or extrapolating them. Both methods are based on use of the finite cardinal series, whose filtering pr

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::d24447b7c898f3ffce6ccf92ee5e7c12
https://doi.org/10.1016/j.jmr.2011.06.002

Zobrazit plný text záznamu

Cardinal series to sort out defective samples in magnetic resonance data sets

Autor: Teddy Fen-Chong, Dimitri Bytchenkoff, Stéphane Rodts, Pascal Moucheront

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2010, 202, pp.147-154. ⟨10.1016/j.jmr.2009.10.010⟩

International audience; NMR signals are unavoidably impaired with noise stemming from the electronic circuits of the spectrometer. This noise is most often white and Gaussian and can be greatly reduced by applying low pass analogue and digital filter

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::a03654cddc08dc197e457b7ef48aa3fd
https://doi.org/10.1016/j.jmr.2009.10.010

Zobrazit plný text záznamu

Measurement of deformations by NMR

Autor: Stéphane Rodts, Dimitri Bytchenkoff

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2015, 261, pp.54-63. ⟨10.1016/j.jmr.2015.10.002⟩

International audience; Two NMR data acquisition protocols together with corresponding data processing algorithms for locating macroscopic objects, measuring distances between them or monitoring their displacements or deformations with microscopic pr

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::c8a4ab9b2a48dd26345b645dd358169f
https://hal.univ-lorraine.fr/hal-01432185

Zobrazit plný text záznamu

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

Autor: Simon Rüdisser, Geoffrey Bodenhausen, Dimitri Bytchenkoff, Elisabetta Chiarparin, Dominique Früh

Publikováno v: Magnetic Resonance in Chemistry. 40:377-379

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 a

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_________::fd38a6c0d9eb2c5cbef47c8be1af1a2b
https://doi.org/10.1002/mrc.1018

Zobrazit plný text záznamu

Structure of the two-dimensional relaxation spectra seen within the eigenmode perturbation theory and the two-site exchange model

Autor: Dimitri Bytchenkoff, Stéphane Rodts

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2010, 208, pp.4-19. ⟨10.1016/j.jmr.2010.09.007⟩

The form of the two-dimensional (2D) NMR-relaxation spectra – which allow to study interstitial fluid dynamics in diffusive systems by correlating spin-lattice ( T 1 ) and spin-spin ( T 2 ) relaxation times – has given rise to numerous conjecture

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::62c90169918a06250bd0255f52fd3cb0
https://hal-enpc.archives-ouvertes.fr/hal-00673315

Zobrazit plný text záznamu

Freezing and melting of water in porous geomaterials studied by magnetic resonance

Autor: Pamela Faure, Cédric Mézière, David Hautemayou, Dimitri Bytchenkoff, Pascal Moucheront, Stéphane Rodts, T. Fen Chong

Publikováno v: EPJ Web of Conferences, Vol 6, p 22011 (2010)
14th ICEM
14th ICEM, Jul 2010, Poitiers, France

We intend to study mechanical effects of freezing and thawing on bulky samples of concrete by nuclear resonance high resolution spectroscopy and imaging (MRI). Variously functionalised three dimensional images of liquid water in the porous media can

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::12fc5b168184ef0ee6bcf8c41fb4bab7
https://doaj.org/article/d4af7b5a950c428b865164fac863a80e

Zobrazit plný text záznamu

Structural properties of 2D NMR relaxation spectra of diffusive systems

Autor: Dimitri Bytchenkoff, Stéphane Rodts

Publikováno v: Journal of Magnetic Resonance
Journal of Magnetic Resonance, Elsevier, 2010, 205, pp.315-318. ⟨10.1016/j.jmr.2010.04.021⟩

International audience; Much has been learnt and speculated about the form of 2D NMR relaxation spectra of diffusive systems. Herein we show that the eigen-modes formalism can help to establish a number of fundamental structural properties, i.e. symm

Externí odkaz: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::6d078c099161e8c1021182d2e56218b0
https://hal.archives-ouvertes.fr/hal-00528325

Zobrazit plný text záznamu

Vyhledávací nástroje:

Upřesnit hledání