Zobrazeno 1 - 10
of 56
pro vyhledávání: '"Chardonnet, Bertrand"'
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
Chardonnet, Bertrand
Th.--Méd. vét.--Paris 12--Alfort, 1983.
Externí odkaz:
http://catalogue.bnf.fr/ark:/12148/cb361049522
Akademický článek
Tento výsledek nelze pro nepřihlášené uživatele zobrazit.
K zobrazení výsledku je třeba se přihlásit.
K zobrazení výsledku je třeba se přihlásit.
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa giraffa (Boddaert, 1784) Diagnosis Anterior horn rudimentary, shanks coloured and fully spotted, three ES in the C1orf74 intron: 24 A=>T, 33 A=>G, 825 C=> G; three ES in the DHX36 intron: 127 G =>A, 449 dAT, 498 A=>G; one ES in the IGF2B1 int
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::23ee85907b17e35c83d9a880507cff3d
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narro
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::5e6b28a926f631f9ac8ff785b56904c2
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p.
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::14fdd80f3d344eb0b1ea8cb7ec79aab8
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa camelopardalis peralta Thomas, 1898 Diagnosis Elongated skull, large spatulate nasal opening, vertically upright direction of the ossicones, fawncoloured patch below the ears, white sparsely spotted occipital region; two ES in the Cytb gene:
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::4ca94f119d94b90532fa61cbb9365e2e
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa giraffa wardi Lydekker, 1904 Giraffa infumata Noack, 1903: 356. Diagnosis Irregular spots, spots on the side of the face restricted to the region below and behind the eyes, two ES in the Cytb gene: 634 C=>T, 705 A=>G. Type material Holotype S
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::b72381d9cfe18abb60c2d883856b9f6b
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::077106bbb4a501d6492d549787283d02
Autor:
Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel, Hassanin, Alexandre
Giraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 s
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_dedup___::19d56f987a57d5b19b421dc089d19dac