Zobrazeno 1 - 10
of 29
pro vyhledávání: '"Britta Rynnel-Dagöö"'
Publikováno v:
Acta oto-laryngologica. 137(12)
Objective To survey long-term hearing outcomes and middle ear pathology in a 30-year follow-up in individuals with onset of recurrent acute otitis media (rAOM) before three years of age. Methods 28 adults, aged 30.1-31.8 years, who originally - at th
Publikováno v:
International Journal of Pediatric Otorhinolaryngology. 72:1225-1233
Summary Objective To establish if otorrhea associated to tympanostomy tubes in infants suffering from recurrent acute otitis media is similar to acute otitis media, and if topical treatment alone is sufficient or if addition of systemic antibiotics i
Autor:
Helena Erlandsson Harris, Tomas Bergman, Hans G. Boman, U. L. F. Andersson, Britta Rynnel-Dagöö, Cecilia K. Zetterström, Olle Söder
Publikováno v:
Pediatric Research. 52:148-154
Antibacterial factors were purified from human adenoid glands by tissue extraction and consecutive steps of reversed-phase chromatography and assayed for bactericidal activity against the airway pathogen Moraxella catarrhalis and also Escherichia col
Publikováno v:
Scandinavian Journal of Infectious Diseases. 33:904-908
Non-typable Haemophilus influenzae (NTHI) and Streptococcus pneumoniae are regarded as the main pathogens in patients with humoral immunodeficiency. These patients have been given IgG replacement therapy since the 1950s. However, a number of individu
Publikováno v:
Annals of the New York Academy of Sciences. 830:32-48
Autor:
T. F. DeMaria, S. I. Pelton, V. M. Howie, Steven S Juhn, G. Mogi, David L. Klein, G. S. Giebink, W. Kuijpers, P. M. McInnes, S. O.M. Hellstrom, J. M. Bernstein, K. Prellner, A. F. Ryan, P. L. Ogra, Stephen J. Barenkamp, W. F. Diven, H. Faden, P. Karma, Britta Rynnel-Dagöö, Lauren O. Bakaletz
Publikováno v:
Annals of Otology, Rhinology & Laryngology. 103:27-43
Autor:
Joachim Forsgren, Anders Samuelson, A. A. Lindberg, Britta Rynnel-Dagöö, A Ahlin, J. Jonasson
Publikováno v:
Infection and Immunity. 62:673-679
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of
Publikováno v:
The Pediatric Infectious Disease Journal. 13:S15-19
It has long been recognized that some children experience more frequent infections than others but that most will grow out of their health problems. In the past relapsing episodes of upper respiratory tract infections have not indicated an underlying
Publikováno v:
Acta Oto-Laryngologica. 113:673-678
The local antibody activity to Streptococcus pneumoniae serotype 6B was measured in nasopharyngeal secretions from 20 healthy adults and 43 children, 1-3 years of age, 14 of whom were healthy and 29 were at risk for developing recurrent episodes of a