Zobrazeno 1 - 10
of 134
pro vyhledávání: '"Aldo Galeone"'
Autor:
Antonella Virgilio, Daniela Benigno, Carla Aliberti, Valentina Vellecco, Mariarosaria Bucci, Veronica Esposito, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 24, Iss 21, p 15529 (2023)
Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therape
Externí odkaz:
https://doaj.org/article/6a75b8c3905a41229b7d777978f38eb0
Autor:
Veronica Esposito, Daniela Benigno, Ivana Bello, Elisabetta Panza, Mariarosaria Bucci, Antonella Virgilio, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 24, Iss 11, p 9524 (2023)
In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce it
Externí odkaz:
https://doaj.org/article/cd610a20688f45cfa2008c43a293de3f
Autor:
Daniela Benigno, Antonella Virgilio, Ivana Bello, Sara La Manna, Valentina Vellecco, Mariarosaria Bucci, Daniela Marasco, Elisabetta Panza, Veronica Esposito, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 23, Iss 23, p 14921 (2022)
In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop a
Externí odkaz:
https://doaj.org/article/cded1a861ade4767852a12b87fcfc7fa
Autor:
Gabriella Misso, Mayra Rachele Zarone, Angela Lombardi, Anna Grimaldi, Alessia Maria Cossu, Carmela Ferri, Margherita Russo, Daniela Cristina Vuoso, Amalia Luce, Hiromichi Kawasaki, Maria Teresa Di Martino, Antonella Virgilio, Agostino Festa, Aldo Galeone, Giuseppe De Rosa, Carlo Irace, Massimo Donadelli, Alois Necas, Evzen Amler, Pierosandro Tagliaferri, Pierfrancesco Tassone, Michele Caraglia
Publikováno v:
Molecular Therapy: Nucleic Acids, Vol 16, Iss , Pp 391-406 (2019)
miR-125b, ubiquitously expressed and frequently dysregulated in several tumors, has gained special interest in the field of cancer research, displaying either oncogenic or oncosuppressor potential based on tumor type. We have previously demonstrated
Externí odkaz:
https://doaj.org/article/43ab1c060b9e4d41bafb080a8b2d16e6
Autor:
Antonella Virgilio, Annalisa Pecoraro, Daniela Benigno, Annapina Russo, Giulia Russo, Veronica Esposito, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 23, Iss 11, p 5952 (2022)
In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with a
Externí odkaz:
https://doaj.org/article/a193ea5f97d543408f105242af4ce494
Autor:
Carmen Festa, Veronica Esposito, Daniela Benigno, Simona De Marino, Angela Zampella, Antonella Virgilio, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 23, Iss 3, p 1092 (2022)
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-brom
Externí odkaz:
https://doaj.org/article/2b394629f4044945bcb2a933f0a5f1ee
Autor:
Antonella Virgilio, Teresa Amato, Luigi Petraccone, Francesca Esposito, Nicole Grandi, Enzo Tramontano, Raquel Romero, Shozeb Haider, Isabel Gomez-Monterrey, Ettore Novellino, Luciano Mayol, Veronica Esposito, Aldo Galeone
Publikováno v:
Scientific Reports, Vol 8, Iss 1, Pp 1-9 (2018)
Abstract In this paper, we report our investigations on analogues of the anti-human immunodeficiency virus type 1 (HIV-1) integrase (IN) aptamer T30175 in which the individual thymidines forming the loops were replaced by 5-hydroxymethyl-2′-deoxyur
Externí odkaz:
https://doaj.org/article/a75cacdbf3dd4a539019f5c9a75a4920
Autor:
Antonella Virgilio, Daniela Benigno, Annalisa Pecoraro, Annapina Russo, Giulia Russo, Veronica Esposito, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 22, Iss 13, p 7040 (2021)
In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and
Externí odkaz:
https://doaj.org/article/a5008e52504a4ffe91988b1da59231ce
Autor:
Ciara K. O’ Sullivan, Teresa Mairal, Miriam Jauset-Rubio, Marketa Svobodova, Vasso Skouridou, Veronica Esposito, Antonella Virgilio, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 22, Iss 3, p 1150 (2021)
In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, β-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G
Externí odkaz:
https://doaj.org/article/cf28bb96576548f4b5e8f501bc030a0c
Autor:
Veronica Esposito, Francesca Esposito, Antonietta Pepe, Isabel Gomez Monterrey, Enzo Tramontano, Luciano Mayol, Antonella Virgilio, Aldo Galeone
Publikováno v:
International Journal of Molecular Sciences, Vol 21, Iss 16, p 5637 (2020)
In this paper, we report studies concerning four variants of the G-quadruplex forming anti-HIV-integrase aptamer T30923, in which specific 2′-deoxyguanosines have been singly replaced by 8-methyl-2′-deoxyguanosine residues, with the aim to exploi
Externí odkaz:
https://doaj.org/article/ce32a1bcec984cdaad90444946aba7e3