Zobrazeno 31 - 40
of 68
pro vyhledávání: '"Usisipho Feleni"'
Autor:
Bhekie B. Mamba, Uyiosa Osagie Aigbe, Seyi Philemon Akanji, Usisipho Feleni, Robert Birundu Onyancha, Kabir Opeyemi Otun, Onoyivwe Monday Ama, Azeez O. Idris, Kingsley Eghonghon Ukhurebor
Publikováno v:
Modified Nanomaterials for Environmental Applications ISBN: 9783030855543
The presence of pharmaceuticals in surface waters called for urgent concern in recent years due to their prospective environmental effects. Various analytical methods including chemiluminescence, high-performance liquid chromatography, capillary elec
Externí odkaz:
https://explore.openaire.eu/search/publication?articleId=doi_________::7abedf713ed34effcdcc45eb50b5d13a
https://doi.org/10.1007/978-3-030-85555-0_8
https://doi.org/10.1007/978-3-030-85555-0_8
Autor:
Usisipho Feleni, Ekemena O. Oseghe, Potlako J. Mafa, Azeez O. Idris, Titus A.M. Msagati, Bhekie B. Mamba
Publikováno v:
Journal of Nanoparticle Research. 23
Herein, a facile approach for preparing nickel oxide nanoparticles coupled with manganese oxide nanorods (NiONPs@MnO2NRs) was reported for the first time. The nickel oxide nanoparticles, manganese oxide nanorods, and nanocomposite material were prepa
Publikováno v:
Environmental pollution (Barking, Essex : 1987). 289
The pollution of water bodies by residual pharmaceuticals is a major problem globally. Bismuth tungstate mediated photocatalysis has been effective in the removal of these organics from water. Bismuth tungstate (Bi
Autor:
Ekemena Oghenovoh, Oseghe, Azeez Olayiwola, Idris, Usisipho, Feleni, Bhekie Brilliance, Mamba, Titus Alfred Makudali, Msagati
Publikováno v:
Environmental science and pollution research internationalReferences. 28(44)
Oxoanions are a class of contaminants that are easily released into the aquatic systems either through natural or anthropogenic activities. Depending on their oxidation states, they are highly mobile, resulting in the contamination of underground wat
Autor:
Potlako J. Mafa, Nonhlangabezo Mabuba, Alex T. Kuvarega, Mope E. Malefane, Bulelwa Ntsendwana, Usisipho Feleni
Publikováno v:
ChemistrySelect. 4:8379-8389
Publikováno v:
Talanta. 196:204-210
A sensitive dendritic star copolymer-based sensor for pyrene (PY), was developed by in situ electrosynthesis of generation 3 poly(propylene thiophenoimine)-co-poly(3-hexylthiophene) (G3PPT-co-P3HT) on a gold disk electrode (Au). The electrochemical r
Autor:
Lindsay Wilson, Nomaphelo Ntshongontshi, Unathi Sidwaba, Tesfaye Waryo, Usisipho Feleni, Emmanuel I. Iwuoha
Publikováno v:
Electrocatalysis. 10:323-331
In addition to attack by communicable diseases and unforeseen outbreak of different pathogens, endocrine-disrupting chemicals (EDCs) destroy the human system. Bisphenol A (BPA) is an endocrine-disrupting chemical found in daily useable plastic-ware a
Publikováno v:
New Journal of Chemistry. 43:11348-11362
Visible light photocatalysis has gained attention as a green chemistry protocol for mineralizing organic pollutants. In this contribution, a series of photocatalysts were prepared via a wet-impregnation method using meso-tetraphenylporphyrin (TPP; 0
Publikováno v:
Processes, Vol 9, Iss 179, p 179 (2021)
Processes
Volume 9
Issue 1
Processes
Volume 9
Issue 1
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
Publikováno v:
Processes; Volume 9; Issue 12; Pages: 2203
Processes, Vol 9, Iss 2203, p 2203 (2021)
Processes, Vol 9, Iss 2203, p 2203 (2021)
Prostate cancer is a dominant global threat to society. It affects nearly 4000 men in South Africa annually, making it the second most threatening cancerous disease after lung cancer. A potential serological biomarker to monitor early diagnosis of pr