Zobrazeno 1 - 7
of 7
pro vyhledávání: '"Usisipho Feleni"'
Publikováno v:
Electrocatalysis. 11:68-76
Indinavir (IDV) is a potent and well-tolerated protease inhibitor antiretroviral (ARV) drug used as a component of the highly active antiretroviral therapy (HAART) of human immunodeficiency virus (HIV). It undergoes hepatic first-pass metabolism that
Publikováno v:
Talanta. 196:204-210
A sensitive dendritic star copolymer-based sensor for pyrene (PY), was developed by in situ electrosynthesis of generation 3 poly(propylene thiophenoimine)-co-poly(3-hexylthiophene) (G3PPT-co-P3HT) on a gold disk electrode (Au). The electrochemical r
Autor:
Lindsay Wilson, Nomaphelo Ntshongontshi, Unathi Sidwaba, Tesfaye Waryo, Usisipho Feleni, Emmanuel I. Iwuoha
Publikováno v:
Electrocatalysis. 10:323-331
In addition to attack by communicable diseases and unforeseen outbreak of different pathogens, endocrine-disrupting chemicals (EDCs) destroy the human system. Bisphenol A (BPA) is an endocrine-disrupting chemical found in daily useable plastic-ware a
Publikováno v:
Processes, Vol 9, Iss 179, p 179 (2021)
Processes
Volume 9
Issue 1
Processes
Volume 9
Issue 1
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
Autor:
Ezo Nxusani, Nomaphelo Ntshongontshi, Rachel Fanelwa Ajayi, Samantha F. Douman, Lindsay Wilson, Anovuyo Jonnas, Keagan Pokpas, Usisipho Feleni, Emmanuel I. Iwuoha
Publikováno v:
Journal of Nano Research. 44:229-251
The Directly Observed Treatment, Short-course (DOTS) constitutes the main strategy for the control of tuberculosis (TB). However, isoniazid (INZ) one of the drugs used in the regimen is potentially hepatotoxic and may lead to drug-associated hepatiti
Autor:
Rachel Fanelwa Ajayi, Emmanuel I. Iwuoha, Samantha F. Douman, Abongile N. Jijana, Usisipho Feleni, Unathi Sidwaba, Priscilla G. L. Baker
Publikováno v:
Journal of Nano Research. 44:196-207
Biocompatibility of tin selenide quantum dots was achieved by the incorporation of 3-mercaptopropionic acid (3-MPA) as a capping agent, which also improved the stability and the solubility of the material. The UV-Vis spectrophotometric analysis of th
Publikováno v:
Journal of nanoscience and nanotechnology. 19(12)
Indinavir is a first-generation HIV protease inhibitor anti-retroviral (ARV) drug. Due to interindividual differences in the rate of indinavir metabolism, clinicians and pharmacologists have expressed urgent need for sensor devices that will enable r