Zobrazeno 1 - 4
of 4
pro vyhledávání: '"Usisipho Feleni"'
Autor:
Hilda Dinah Kyomuhimbo, Immaculate Nyambura Michira, Emmanuel Iheanyichukwu Iwuoha, Usisipho Feleni
Publikováno v:
Processes; Volume 10; Issue 3; Pages: 457
Metal-conducting polyaniline (PANI)-based nanocomposite materials have attracted attention in various applications due to their synergism of electrical, mechanical, and optical properties of the initial components. Herein, metal-PANI nanocomposites,
Publikováno v:
Processes, Vol 9, Iss 179, p 179 (2021)
Processes
Volume 9
Issue 1
Processes
Volume 9
Issue 1
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
R, l-arginine) (MC-LR) containing a 5&prime
thiolated 60-mer DNA aptamer (i.e., 5&prime
SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCA
Publikováno v:
Processes; Volume 9; Issue 12; Pages: 2203
Processes, Vol 9, Iss 2203, p 2203 (2021)
Processes, Vol 9, Iss 2203, p 2203 (2021)
Prostate cancer is a dominant global threat to society. It affects nearly 4000 men in South Africa annually, making it the second most threatening cancerous disease after lung cancer. A potential serological biomarker to monitor early diagnosis of pr
Publikováno v:
Journal of Environmental Chemical Engineering. 8:103560
Diclofenac sodium salt (DFC) is one of the new and emerging pollutants emanating from pharmaceuticals which are essential for animals and humans detected in drinking water effluents. DFC removal is a concern as it has been implicated in adverse healt